Incidental Mutation 'R7885:Crhbp'
ID609028
Institutional Source Beutler Lab
Gene Symbol Crhbp
Ensembl Gene ENSMUSG00000021680
Gene Namecorticotropin releasing hormone binding protein
SynonymsCRH-BP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7885 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location95431371-95444924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95432007 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 307 (Q307R)
Ref Sequence ENSEMBL: ENSMUSP00000042578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045583] [ENSMUST00000221025]
Predicted Effect probably damaging
Transcript: ENSMUST00000045583
AA Change: Q307R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042578
Gene: ENSMUSG00000021680
AA Change: Q307R

DomainStartEndE-ValueType
Pfam:CRF-BP 1 307 1.1e-179 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000221025
AA Change: Q300R

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Corticotropin-releasing hormone is a potent stimulator of synthesis and secretion of preopiomelanocortin-derived peptides. Although CRH concentrations in the human peripheral circulation are normally low, they increase throughout pregnancy and fall rapidly after parturition. Maternal plasma CRH probably originates from the placenta. Human plasma contains a CRH-binding protein which inactivates CRH and which may prevent inappropriate pituitary-adrenal stimulation in pregnancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display behavior indicative of increased anxiety. Male mice also show reduced food intake resulting in reduced growth between ages 7 and 15 weeks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo TCTAT TCTATACTAT 5: 14,714,191 probably null Het
Pclo T TTCTAG 5: 14,714,195 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Pstpip2 C A 18: 77,794,722 T2K probably benign Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Crhbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Crhbp APN 13 95443787 missense probably damaging 0.96
IGL03058:Crhbp APN 13 95443798 missense probably damaging 1.00
R0518:Crhbp UTSW 13 95443895 critical splice acceptor site probably null
R0521:Crhbp UTSW 13 95443895 critical splice acceptor site probably null
R1120:Crhbp UTSW 13 95442085 missense probably benign 0.01
R4417:Crhbp UTSW 13 95443877 missense probably benign 0.02
R4925:Crhbp UTSW 13 95443810 missense possibly damaging 0.93
R4999:Crhbp UTSW 13 95442245 missense probably damaging 1.00
R5332:Crhbp UTSW 13 95436455 missense probably damaging 0.99
R5568:Crhbp UTSW 13 95442229 missense probably damaging 1.00
R5857:Crhbp UTSW 13 95442232 missense probably benign 0.01
R5861:Crhbp UTSW 13 95443825 missense probably damaging 1.00
R5875:Crhbp UTSW 13 95443796 missense probably benign 0.00
R5911:Crhbp UTSW 13 95432056 missense probably benign 0.00
R6235:Crhbp UTSW 13 95443850 missense probably damaging 1.00
R7038:Crhbp UTSW 13 95444191 missense probably damaging 1.00
R8479:Crhbp UTSW 13 95442124 missense possibly damaging 0.94
X0052:Crhbp UTSW 13 95431993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGGCCTGGAGTACTGATTG -3'
(R):5'- GCAAGATGCCATATATCCCTGG -3'

Sequencing Primer
(F):5'- CCTGGAGTACTGATTGGAAGACTTTC -3'
(R):5'- AAGATGCCATATATCCCTGGTCTCC -3'
Posted On2019-12-20