Incidental Mutation 'R7885:Mlc1'
ID609033
Institutional Source Beutler Lab
Gene Symbol Mlc1
Ensembl Gene ENSMUSG00000035805
Gene Namemegalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human)
SynonymsWKL1, Kiaa0027-hp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7885 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location88955884-88979007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88977904 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 36 (D36E)
Ref Sequence ENSEMBL: ENSMUSP00000104993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042594] [ENSMUST00000109368]
Predicted Effect probably benign
Transcript: ENSMUST00000042594
AA Change: D30E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000047667
Gene: ENSMUSG00000035805
AA Change: D30E

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 266 288 N/A INTRINSIC
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109368
AA Change: D36E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000104993
Gene: ENSMUSG00000035805
AA Change: D36E

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 314 336 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene product is unknown; however, homology to other proteins suggests that it may be an integral membrane transporter. Mutations in this gene have been associated with megalencephalic leukoencephalopathy with subcortical cysts, an autosomal recessive neurological disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit myelin vacuolization that progresses with age, and show alterations in glial cell and oligodendrocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo TCTAT TCTATACTAT 5: 14,714,191 probably null Het
Pclo T TTCTAG 5: 14,714,195 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Pstpip2 C A 18: 77,794,722 T2K probably benign Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Mlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Mlc1 APN 15 88974718 splice site probably benign
IGL03251:Mlc1 APN 15 88974731 missense possibly damaging 0.88
R0710:Mlc1 UTSW 15 88977864 missense possibly damaging 0.88
R1037:Mlc1 UTSW 15 88965461 missense probably damaging 1.00
R1573:Mlc1 UTSW 15 88958147 missense probably damaging 1.00
R1994:Mlc1 UTSW 15 88974579 missense possibly damaging 0.50
R2121:Mlc1 UTSW 15 88963431 missense probably benign 0.22
R2302:Mlc1 UTSW 15 88965437 missense possibly damaging 0.63
R3110:Mlc1 UTSW 15 88965996 missense probably benign 0.00
R3112:Mlc1 UTSW 15 88965996 missense probably benign 0.00
R3117:Mlc1 UTSW 15 88976528 missense probably damaging 1.00
R4027:Mlc1 UTSW 15 88966494 missense probably benign 0.29
R4450:Mlc1 UTSW 15 88963490 missense probably benign 0.19
R4576:Mlc1 UTSW 15 88974537 missense probably damaging 1.00
R4697:Mlc1 UTSW 15 88974777 missense probably damaging 1.00
R4728:Mlc1 UTSW 15 88978031 splice site probably null
R4910:Mlc1 UTSW 15 88958212 missense possibly damaging 0.94
R5618:Mlc1 UTSW 15 88974566 missense probably damaging 1.00
R7528:Mlc1 UTSW 15 88974507 missense possibly damaging 0.95
R7746:Mlc1 UTSW 15 88964170 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGTCTATCGGGCTTTGTG -3'
(R):5'- GTCAAAGTCCATGATGATTTCACTGC -3'

Sequencing Primer
(F):5'- TTGTGCTCTACAGGGCATGACC -3'
(R):5'- CCATGATGATTTCACTGCATAGGAGG -3'
Posted On2019-12-20