Incidental Mutation 'R7885:Bin1'
ID609037
Institutional Source Beutler Lab
Gene Symbol Bin1
Ensembl Gene ENSMUSG00000024381
Gene Namebridging integrator 1
SynonymsAmphl, Amphiphysin 2
MMRRC Submission
Accession Numbers

Genbank: NM_009668, NM_001083334; MGI: 108092

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7885 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location32377217-32435736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32419843 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 174 (A174T)
Ref Sequence ENSEMBL: ENSMUSP00000089590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025239] [ENSMUST00000091967]
Predicted Effect probably damaging
Transcript: ENSMUST00000025239
AA Change: A205T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025239
Gene: ENSMUSG00000024381
AA Change: A205T

DomainStartEndE-ValueType
BAR 17 269 3.04e-81 SMART
low complexity region 296 305 N/A INTRINSIC
PDB:1MV3|A 306 378 3e-31 PDB
Blast:BAR 395 506 4e-48 BLAST
SH3 518 588 5.4e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091967
AA Change: A174T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089590
Gene: ENSMUSG00000024381
AA Change: A174T

DomainStartEndE-ValueType
BAR 17 238 3.92e-84 SMART
low complexity region 265 274 N/A INTRINSIC
low complexity region 309 315 N/A INTRINSIC
Blast:BAR 319 395 2e-8 BLAST
SH3 407 477 5.4e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes several isoforms of a nucleocytoplasmic adaptor protein, one of which was initially identified as a MYC-interacting protein with features of a tumor suppressor. Isoforms that are expressed in the central nervous system may be involved in synaptic vesicle endocytosis and may interact with dynamin, synaptojanin, endophilin, and clathrin. Isoforms that are expressed in muscle and ubiquitously expressed isoforms localize to the cytoplasm and nucleus and activate a caspase-independent apoptotic process. Studies in mouse suggest that this gene plays an important role in cardiac muscle development. Alternate splicing of the gene results in several transcript variants encoding different isoforms. Aberrant splice variants expressed in tumor cell lines have also been described. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutation of this gene results in thickened ventricular walls, densely packed myocardiocytes, and disorganization of myofibrils. Mutant animals die shortly after birth. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo TCTAT TCTATACTAT 5: 14,714,191 probably null Het
Pclo T TTCTAG 5: 14,714,195 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Pstpip2 C A 18: 77,794,722 T2K probably benign Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Bin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Bin1 APN 18 32420107 missense probably damaging 1.00
IGL00972:Bin1 APN 18 32424834 missense probably benign 0.01
IGL01551:Bin1 APN 18 32377458 missense probably benign 0.44
IGL01609:Bin1 APN 18 32419925 missense probably damaging 1.00
R1370:Bin1 UTSW 18 32429703 missense probably benign 0.05
R1496:Bin1 UTSW 18 32412704 missense probably damaging 0.99
R1688:Bin1 UTSW 18 32419935 splice site probably benign
R1688:Bin1 UTSW 18 32424972 splice site probably benign
R2483:Bin1 UTSW 18 32414227 missense probably damaging 1.00
R3941:Bin1 UTSW 18 32406158 missense probably damaging 1.00
R5026:Bin1 UTSW 18 32419930 critical splice donor site probably null
R5768:Bin1 UTSW 18 32426211 splice site probably null
R6770:Bin1 UTSW 18 32406149 missense probably damaging 1.00
R6906:Bin1 UTSW 18 32421925 missense probably benign 0.00
R7239:Bin1 UTSW 18 32406171 missense probably damaging 1.00
R7593:Bin1 UTSW 18 32419879 nonsense probably null
R8050:Bin1 UTSW 18 32406145 missense probably damaging 1.00
R8089:Bin1 UTSW 18 32429183 splice site probably null
R8342:Bin1 UTSW 18 32413113 missense probably benign
X0011:Bin1 UTSW 18 32426279 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGGCAGCTCAACCTTCC -3'
(R):5'- ATGCTGCATCCTCAGAGACAC -3'

Sequencing Primer
(F):5'- CCTTAGGGCTCCAATGGGAAGTTC -3'
(R):5'- CACAGAGCCCTGAAGTCAGTAG -3'
Posted On2019-12-20