Incidental Mutation 'R7886:Pde11a'
ID609041
Institutional Source Beutler Lab
Gene Symbol Pde11a
Ensembl Gene ENSMUSG00000075270
Gene Namephosphodiesterase 11A
SynonymsA630086N24Rik, 6330414F14Rik
Accession Numbers

Genbank: NM_001081033; MGI: 3036251

Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R7886 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location75989141-76338774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76291203 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 345 (V345I)
Ref Sequence ENSEMBL: ENSMUSP00000097572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099992]
Predicted Effect probably benign
Transcript: ENSMUST00000099992
AA Change: V345I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097572
Gene: ENSMUSG00000075270
AA Change: V345I

DomainStartEndE-ValueType
low complexity region 68 82 N/A INTRINSIC
low complexity region 149 164 N/A INTRINSIC
GAF 217 380 1.79e-30 SMART
GAF 402 568 2.34e-25 SMART
HDc 661 830 7.75e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 3',5'-cyclic nucleotides cAMP and cGMP function as second messengers in a wide variety of signal transduction pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and cGMP to the corresponding 5'-monophosphates and provide a mechanism to downregulate cAMP and cGMP signaling. This gene encodes a member of the PDE protein superfamily. Mutations in this gene are a cause of Cushing disease and adrenocortical hyperplasia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have enlarged lateral ventricles and exhibit abnormal behavior. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T G 6: 92,834,456 I130S unknown Het
Ano5 A G 7: 51,570,393 H427R probably benign Het
Atad2 A T 15: 58,126,136 V182E probably damaging Het
B4galnt1 T C 10: 127,167,054 Y147H probably damaging Het
C1s2 T C 6: 124,628,330 S349G possibly damaging Het
Ccdc51 G T 9: 109,091,587 A181S probably damaging Het
Dcc G A 18: 71,954,868 Q100* probably null Het
Dchs2 A T 3: 83,305,085 I2064F probably damaging Het
Depdc1a G A 3: 159,516,069 V217I probably benign Het
Dnajc7 A T 11: 100,601,803 F31I probably benign Het
Eftud2 C T 11: 102,840,108 R825H probably damaging Het
Fam184a T C 10: 53,675,160 E237G probably damaging Het
Frem1 T C 4: 83,016,406 D106G possibly damaging Het
Gabrg3 G A 7: 56,724,481 R446W probably damaging Het
Gm42669 A G 5: 107,508,706 E362G Het
Hmcn1 A T 1: 150,657,470 I3022N possibly damaging Het
Ifna2 C A 4: 88,683,269 V171F probably damaging Het
Igsf10 T C 3: 59,328,327 N1478D probably benign Het
Kcnc1 C A 7: 46,427,621 D282E probably damaging Het
Macrod2 G A 2: 141,724,645 G188S probably damaging Het
Mapkbp1 T C 2: 120,012,647 F186L possibly damaging Het
Mettl21a T C 1: 64,615,184 E58G probably damaging Het
Muc16 A T 9: 18,585,982 C6625S probably benign Het
Naip5 A T 13: 100,246,181 S7T probably benign Het
Nfs1 T A 2: 156,142,061 D132V unknown Het
Nlgn1 T C 3: 25,435,907 D552G probably damaging Het
Numa1 C T 7: 102,013,865 T2066I probably benign Het
Olfr1355 A G 10: 78,879,823 Y217C possibly damaging Het
Olfr330 C A 11: 58,529,054 V311L probably benign Het
Olfr370 T C 8: 83,541,947 S268P possibly damaging Het
Olfr730 A T 14: 50,186,564 Y219N probably damaging Het
Pglyrp2 A G 17: 32,418,761 S98P possibly damaging Het
Pik3c3 C T 18: 30,319,588 Q643* probably null Het
Pold2 T C 11: 5,872,714 Y402C probably damaging Het
Pom121 T C 5: 135,381,994 T770A unknown Het
Pou4f1 A T 14: 104,466,792 V68E probably damaging Het
Ppfia1 G T 7: 144,519,283 Q265K probably benign Het
Rdh19 A G 10: 127,850,300 T94A probably benign Het
Scgb1b12 A G 7: 32,334,497 T61A probably damaging Het
Sirpb1c C T 3: 15,832,202 A337T probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Synpo2 GTCCTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTCCTC 3: 123,114,418 probably benign Het
Tbc1d23 T C 16: 57,189,383 E381G possibly damaging Het
Tnik A G 3: 28,666,139 I1304V probably damaging Het
Tpmt C A 13: 47,040,162 G54C probably damaging Het
Usp25 A T 16: 77,113,771 Q905L probably damaging Het
Vmn1r91 T A 7: 20,101,565 N136K probably benign Het
Wdr70 C T 15: 8,079,249 E138K probably benign Het
Wrb T A 16: 96,145,568 L31Q possibly damaging Het
Zbed3 A G 13: 95,336,125 D19G possibly damaging Het
Zfp369 A G 13: 65,292,054 K184R possibly damaging Het
Other mutations in Pde11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Pde11a APN 2 76215385 missense probably damaging 1.00
IGL01528:Pde11a APN 2 76194956 splice site probably benign
IGL02117:Pde11a APN 2 75991262 missense probably damaging 1.00
IGL02428:Pde11a APN 2 76046845 missense possibly damaging 0.68
IGL02455:Pde11a APN 2 76158393 missense possibly damaging 0.58
IGL02731:Pde11a APN 2 75991239 missense probably benign 0.00
IGL03068:Pde11a APN 2 76017864 missense probably damaging 1.00
IGL03081:Pde11a APN 2 76075930 splice site probably benign
D4186:Pde11a UTSW 2 76291290 missense probably damaging 1.00
R0323:Pde11a UTSW 2 76046774 splice site probably null
R0433:Pde11a UTSW 2 76337706 missense possibly damaging 0.47
R1226:Pde11a UTSW 2 76158354 missense probably benign 0.10
R1542:Pde11a UTSW 2 76046855 missense probably benign 0.25
R1941:Pde11a UTSW 2 76291250 missense probably benign 0.10
R2107:Pde11a UTSW 2 76337922 missense probably damaging 1.00
R2394:Pde11a UTSW 2 76059061 missense probably benign 0.00
R3689:Pde11a UTSW 2 76291166 missense probably damaging 1.00
R3690:Pde11a UTSW 2 76291166 missense probably damaging 1.00
R3945:Pde11a UTSW 2 76075931 splice site probably benign
R4073:Pde11a UTSW 2 76337898 missense probably damaging 1.00
R4074:Pde11a UTSW 2 76337898 missense probably damaging 1.00
R4588:Pde11a UTSW 2 76029303 missense probably damaging 1.00
R4602:Pde11a UTSW 2 76158333 missense probably benign 0.05
R4604:Pde11a UTSW 2 76337793 missense possibly damaging 0.89
R4609:Pde11a UTSW 2 76291241 missense possibly damaging 0.94
R4610:Pde11a UTSW 2 76158333 missense probably benign 0.05
R5017:Pde11a UTSW 2 76136367 missense probably benign 0.05
R5519:Pde11a UTSW 2 76075955 missense probably damaging 1.00
R5930:Pde11a UTSW 2 76139831 splice site probably null
R6000:Pde11a UTSW 2 76017860 missense probably damaging 0.98
R6018:Pde11a UTSW 2 76017850 missense probably benign 0.00
R6913:Pde11a UTSW 2 76337740 missense probably damaging 1.00
R7117:Pde11a UTSW 2 76076004 missense probably damaging 1.00
R7258:Pde11a UTSW 2 76139906 missense possibly damaging 0.91
R7267:Pde11a UTSW 2 76337845 missense probably damaging 1.00
R7409:Pde11a UTSW 2 76005984 missense
R7451:Pde11a UTSW 2 76022773 missense possibly damaging 0.89
R7452:Pde11a UTSW 2 76136414 missense probably damaging 1.00
R7598:Pde11a UTSW 2 76136423 missense probably damaging 1.00
R7671:Pde11a UTSW 2 76215353 missense possibly damaging 0.81
R7969:Pde11a UTSW 2 76291203 missense probably benign
R8045:Pde11a UTSW 2 76022728 missense probably damaging 0.99
Z1176:Pde11a UTSW 2 76194905 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTAGGACAGCATAGAGAAAGCTC -3'
(R):5'- TCCCTAAGAATAAAAGCCGGGG -3'

Sequencing Primer
(F):5'- GAAAGCTCTTTGATCTGTGAATAGGC -3'
(R):5'- GAGCTTTCCTAGGGCCTTGC -3'
Posted On2019-12-20