Incidental Mutation 'R7886:Sirpb1c'
ID 609045
Institutional Source Beutler Lab
Gene Symbol Sirpb1c
Ensembl Gene ENSMUSG00000074677
Gene Name signal-regulatory protein beta 1C
Synonyms
MMRRC Submission 045938-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R7886 (G1)
Quality Score 110.008
Status Not validated
Chromosome 3
Chromosomal Location 15849311-15902694 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 15886366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 337 (A337T)
Ref Sequence ENSEMBL: ENSMUSP00000103989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050623] [ENSMUST00000108349] [ENSMUST00000108350] [ENSMUST00000108352] [ENSMUST00000108354]
AlphaFold K7N6K7
Predicted Effect probably benign
Transcript: ENSMUST00000050623
AA Change: A337T

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000061216
Gene: ENSMUSG00000074677
AA Change: A337T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108349
AA Change: A335T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103986
Gene: ENSMUSG00000074677
AA Change: A335T

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
IG 35 141 3.51e-8 SMART
IGc1 161 234 4.07e-4 SMART
IGc1 264 337 2.21e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108350
AA Change: A337T

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103987
Gene: ENSMUSG00000074677
AA Change: A337T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108352
AA Change: A337T

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103989
Gene: ENSMUSG00000074677
AA Change: A337T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108354
AA Change: A337T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103991
Gene: ENSMUSG00000074677
AA Change: A337T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000120527
Gene: ENSMUSG00000074677
AA Change: A205T

DomainStartEndE-ValueType
IGc1 32 105 4.07e-4 SMART
IGc1 135 208 2.21e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T G 6: 92,811,437 (GRCm39) I130S unknown Het
Ano5 A G 7: 51,220,141 (GRCm39) H427R probably benign Het
Atad2 A T 15: 57,989,532 (GRCm39) V182E probably damaging Het
B4galnt1 T C 10: 127,002,923 (GRCm39) Y147H probably damaging Het
C1s2 T C 6: 124,605,289 (GRCm39) S349G possibly damaging Het
Ccdc51 G T 9: 108,920,655 (GRCm39) A181S probably damaging Het
Dcc G A 18: 72,087,939 (GRCm39) Q100* probably null Het
Dchs2 A T 3: 83,212,392 (GRCm39) I2064F probably damaging Het
Depdc1a G A 3: 159,221,706 (GRCm39) V217I probably benign Het
Dnajc7 A T 11: 100,492,629 (GRCm39) F31I probably benign Het
Eftud2 C T 11: 102,730,934 (GRCm39) R825H probably damaging Het
Fam184a T C 10: 53,551,256 (GRCm39) E237G probably damaging Het
Fdx2 A T 9: 20,984,623 (GRCm39) probably null Het
Frem1 T C 4: 82,934,643 (GRCm39) D106G possibly damaging Het
Gabrg3 G A 7: 56,374,229 (GRCm39) R446W probably damaging Het
Get1 T A 16: 95,946,768 (GRCm39) L31Q possibly damaging Het
Gm42669 A G 5: 107,656,572 (GRCm39) E362G Het
Hmcn1 A T 1: 150,533,221 (GRCm39) I3022N possibly damaging Het
Ifna2 C A 4: 88,601,506 (GRCm39) V171F probably damaging Het
Igsf10 T C 3: 59,235,748 (GRCm39) N1478D probably benign Het
Kcnc1 C A 7: 46,077,045 (GRCm39) D282E probably damaging Het
Klhdc2 G A 12: 69,351,406 (GRCm39) probably null Het
Macrod2 G A 2: 141,566,565 (GRCm39) G188S probably damaging Het
Mapkbp1 T C 2: 119,843,128 (GRCm39) F186L possibly damaging Het
Mettl21a T C 1: 64,654,343 (GRCm39) E58G probably damaging Het
Muc16 A T 9: 18,497,278 (GRCm39) C6625S probably benign Het
Naip5 A T 13: 100,382,689 (GRCm39) S7T probably benign Het
Nfs1 T A 2: 155,983,981 (GRCm39) D132V unknown Het
Nlgn1 T C 3: 25,490,071 (GRCm39) D552G probably damaging Het
Numa1 C T 7: 101,663,072 (GRCm39) T2066I probably benign Het
Or10k2 T C 8: 84,268,576 (GRCm39) S268P possibly damaging Het
Or2t48 C A 11: 58,419,880 (GRCm39) V311L probably benign Het
Or4k2 A T 14: 50,424,021 (GRCm39) Y219N probably damaging Het
Or7a39 A G 10: 78,715,657 (GRCm39) Y217C possibly damaging Het
Or7g29 A T 9: 19,287,202 (GRCm39) probably null Het
Pde11a C T 2: 76,121,547 (GRCm39) V345I probably benign Het
Pglyrp2 A G 17: 32,637,735 (GRCm39) S98P possibly damaging Het
Pik3c3 C T 18: 30,452,641 (GRCm39) Q643* probably null Het
Pold2 T C 11: 5,822,714 (GRCm39) Y402C probably damaging Het
Pom121 T C 5: 135,410,848 (GRCm39) T770A unknown Het
Pou4f1 A T 14: 104,704,228 (GRCm39) V68E probably damaging Het
Ppfia1 G T 7: 144,073,020 (GRCm39) Q265K probably benign Het
Pygl A G 12: 70,253,130 (GRCm39) probably null Het
Rdh19 A G 10: 127,686,169 (GRCm39) T94A probably benign Het
Scgb1b12 A G 7: 32,033,922 (GRCm39) T61A probably damaging Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Tbc1d23 T C 16: 57,009,746 (GRCm39) E381G possibly damaging Het
Tnik A G 3: 28,720,288 (GRCm39) I1304V probably damaging Het
Tpmt C A 13: 47,193,638 (GRCm39) G54C probably damaging Het
Usp25 A T 16: 76,910,659 (GRCm39) Q905L probably damaging Het
Vmn1r91 T A 7: 19,835,490 (GRCm39) N136K probably benign Het
Wdr70 C T 15: 8,108,733 (GRCm39) E138K probably benign Het
Zbed3 A G 13: 95,472,633 (GRCm39) D19G possibly damaging Het
Zfp369 A G 13: 65,439,868 (GRCm39) K184R possibly damaging Het
Other mutations in Sirpb1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Sirpb1c APN 3 15,892,937 (GRCm39) missense probably benign 0.06
R0094:Sirpb1c UTSW 3 15,892,922 (GRCm39) missense possibly damaging 0.73
R0356:Sirpb1c UTSW 3 15,887,309 (GRCm39) missense possibly damaging 0.95
R0442:Sirpb1c UTSW 3 15,856,710 (GRCm39) missense probably benign 0.09
R3731:Sirpb1c UTSW 3 15,887,287 (GRCm39) missense probably damaging 1.00
R4812:Sirpb1c UTSW 3 15,887,386 (GRCm39) missense probably damaging 0.99
R5802:Sirpb1c UTSW 3 15,886,240 (GRCm39) missense probably benign 0.00
R6315:Sirpb1c UTSW 3 15,886,470 (GRCm39) missense possibly damaging 0.71
R7107:Sirpb1c UTSW 3 15,892,941 (GRCm39) missense possibly damaging 0.91
R7148:Sirpb1c UTSW 3 15,887,223 (GRCm39) nonsense probably null
R7349:Sirpb1c UTSW 3 15,886,310 (GRCm39) critical splice donor site probably null
R7356:Sirpb1c UTSW 3 15,886,297 (GRCm39) missense probably benign
R7359:Sirpb1c UTSW 3 15,887,389 (GRCm39) missense probably benign 0.02
R7466:Sirpb1c UTSW 3 15,886,430 (GRCm39) missense probably damaging 1.00
R7629:Sirpb1c UTSW 3 15,902,559 (GRCm39) missense possibly damaging 0.86
R7720:Sirpb1c UTSW 3 15,886,236 (GRCm39) missense probably benign 0.00
R7726:Sirpb1c UTSW 3 15,902,550 (GRCm39) missense possibly damaging 0.92
R7853:Sirpb1c UTSW 3 15,887,156 (GRCm39) missense probably damaging 1.00
R8519:Sirpb1c UTSW 3 15,902,526 (GRCm39) missense possibly damaging 0.72
R8847:Sirpb1c UTSW 3 15,886,584 (GRCm39) nonsense probably null
R8854:Sirpb1c UTSW 3 15,887,308 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACGTGTGAGAAGTTGGGAAT -3'
(R):5'- GTTCTATCCTCCAAGGTTTCAGG -3'

Sequencing Primer
(F):5'- GTTGGGAATGAAATATGACGTTAAC -3'
(R):5'- CTCCAAGGTTTCAGGTGACC -3'
Posted On 2019-12-20