Incidental Mutation 'R7886:Frem1'
ID609052
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene NameFras1 related extracellular matrix protein 1
Synonymseyes2, heb, eye, crf11, QBRICK
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R7886 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location82897920-83052339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83016406 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 106 (D106G)
Ref Sequence ENSEMBL: ENSMUSP00000071627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071708
AA Change: D106G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: D106G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107230
AA Change: D106G

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: D106G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170248
AA Change: D106G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: D106G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Meta Mutation Damage Score 0.1155 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T G 6: 92,834,456 I130S unknown Het
Ano5 A G 7: 51,570,393 H427R probably benign Het
Atad2 A T 15: 58,126,136 V182E probably damaging Het
B4galnt1 T C 10: 127,167,054 Y147H probably damaging Het
C1s2 T C 6: 124,628,330 S349G possibly damaging Het
Ccdc51 G T 9: 109,091,587 A181S probably damaging Het
Dcc G A 18: 71,954,868 Q100* probably null Het
Dchs2 A T 3: 83,305,085 I2064F probably damaging Het
Depdc1a G A 3: 159,516,069 V217I probably benign Het
Dnajc7 A T 11: 100,601,803 F31I probably benign Het
Eftud2 C T 11: 102,840,108 R825H probably damaging Het
Fam184a T C 10: 53,675,160 E237G probably damaging Het
Fdx1l A T 9: 21,073,327 probably null Het
Gabrg3 G A 7: 56,724,481 R446W probably damaging Het
Gm42669 A G 5: 107,508,706 E362G Het
Hmcn1 A T 1: 150,657,470 I3022N possibly damaging Het
Ifna2 C A 4: 88,683,269 V171F probably damaging Het
Igsf10 T C 3: 59,328,327 N1478D probably benign Het
Kcnc1 C A 7: 46,427,621 D282E probably damaging Het
Klhdc2 G A 12: 69,304,632 probably null Het
Macrod2 G A 2: 141,724,645 G188S probably damaging Het
Mapkbp1 T C 2: 120,012,647 F186L possibly damaging Het
Mettl21a T C 1: 64,615,184 E58G probably damaging Het
Muc16 A T 9: 18,585,982 C6625S probably benign Het
Naip5 A T 13: 100,246,181 S7T probably benign Het
Nfs1 T A 2: 156,142,061 D132V unknown Het
Nlgn1 T C 3: 25,435,907 D552G probably damaging Het
Numa1 C T 7: 102,013,865 T2066I probably benign Het
Olfr1355 A G 10: 78,879,823 Y217C possibly damaging Het
Olfr330 C A 11: 58,529,054 V311L probably benign Het
Olfr370 T C 8: 83,541,947 S268P possibly damaging Het
Olfr730 A T 14: 50,186,564 Y219N probably damaging Het
Olfr847 A T 9: 19,375,906 probably null Het
Pde11a C T 2: 76,291,203 V345I probably benign Het
Pglyrp2 A G 17: 32,418,761 S98P possibly damaging Het
Pik3c3 C T 18: 30,319,588 Q643* probably null Het
Pold2 T C 11: 5,872,714 Y402C probably damaging Het
Pom121 T C 5: 135,381,994 T770A unknown Het
Pou4f1 A T 14: 104,466,792 V68E probably damaging Het
Ppfia1 G T 7: 144,519,283 Q265K probably benign Het
Pygl A G 12: 70,206,356 probably null Het
Rdh19 A G 10: 127,850,300 T94A probably benign Het
Scgb1b12 A G 7: 32,334,497 T61A probably damaging Het
Sirpb1c C T 3: 15,832,202 A337T probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tbc1d23 T C 16: 57,189,383 E381G possibly damaging Het
Tnik A G 3: 28,666,139 I1304V probably damaging Het
Tpmt C A 13: 47,040,162 G54C probably damaging Het
Usp25 A T 16: 77,113,771 Q905L probably damaging Het
Vmn1r91 T A 7: 20,101,565 N136K probably benign Het
Wdr70 C T 15: 8,079,249 E138K probably benign Het
Wrb T A 16: 96,145,568 L31Q possibly damaging Het
Zbed3 A G 13: 95,336,125 D19G possibly damaging Het
Zfp369 A G 13: 65,292,054 K184R possibly damaging Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82959389 missense possibly damaging 0.46
IGL01069:Frem1 APN 4 83013867 missense probably benign 0.00
IGL01106:Frem1 APN 4 82922257 missense probably benign 0.00
IGL01398:Frem1 APN 4 82950362 missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82936139 missense probably benign 0.02
IGL01647:Frem1 APN 4 82950356 missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82959296 splice site probably benign
IGL02006:Frem1 APN 4 82992800 critical splice donor site probably null
IGL02069:Frem1 APN 4 82903551 missense probably damaging 1.00
IGL02131:Frem1 APN 4 82924854 missense probably benign 0.03
IGL02225:Frem1 APN 4 82940506 missense probably damaging 1.00
IGL02439:Frem1 APN 4 82956345 missense probably benign 0.00
IGL02567:Frem1 APN 4 83000055 missense probably damaging 1.00
IGL02647:Frem1 APN 4 83001754 missense probably damaging 1.00
IGL02653:Frem1 APN 4 82959334 missense probably benign 0.22
IGL02831:Frem1 APN 4 82956158 missense probably benign 0.31
IGL02997:Frem1 APN 4 82934968 missense probably damaging 1.00
IGL03005:Frem1 APN 4 82994134 missense probably damaging 1.00
IGL03036:Frem1 APN 4 82959339 missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82994026 splice site probably benign
IGL03218:Frem1 APN 4 82914646 missense probably benign 0.00
IGL03235:Frem1 APN 4 83020755 missense possibly damaging 0.87
IGL03243:Frem1 APN 4 83013969 missense probably damaging 1.00
bat UTSW 4 82983060 intron probably benign
R0519_frem1_373 UTSW 4 82970633 critical splice donor site probably null
R1115_Frem1_145 UTSW 4 83020770 missense probably benign 0.28
R4764_Frem1_085 UTSW 4 82989189 missense probably damaging 1.00
R6165_Frem1_083 UTSW 4 82956255 missense probably benign 0.16
R6324_Frem1_643 UTSW 4 82983337 missense probably benign 0.00
PIT4131001:Frem1 UTSW 4 83005808 missense probably damaging 0.99
PIT4466001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4472001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4515001:Frem1 UTSW 4 82900426 missense probably damaging 0.98
PIT4531001:Frem1 UTSW 4 82950280 missense probably benign 0.12
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0115:Frem1 UTSW 4 82936169 missense possibly damaging 0.94
R0125:Frem1 UTSW 4 83011951 missense probably damaging 1.00
R0280:Frem1 UTSW 4 82969444 missense probably damaging 1.00
R0504:Frem1 UTSW 4 82912637 missense probably benign 0.26
R0519:Frem1 UTSW 4 82970633 critical splice donor site probably null
R0631:Frem1 UTSW 4 82972165 missense probably damaging 1.00
R0645:Frem1 UTSW 4 82989166 missense probably damaging 1.00
R0781:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1110:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1115:Frem1 UTSW 4 83020770 missense probably benign 0.28
R1130:Frem1 UTSW 4 82916628 splice site probably null
R1173:Frem1 UTSW 4 82950352 missense probably benign 0.16
R1349:Frem1 UTSW 4 82922305 splice site probably benign
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1658:Frem1 UTSW 4 83001808 missense probably damaging 1.00
R1672:Frem1 UTSW 4 82998891 missense probably benign 0.09
R1831:Frem1 UTSW 4 83020837 missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82950500 missense probably damaging 0.98
R2014:Frem1 UTSW 4 83005852 missense probably damaging 1.00
R2021:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2022:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2023:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2183:Frem1 UTSW 4 82991495 missense probably benign 0.00
R2437:Frem1 UTSW 4 83000173 missense probably damaging 1.00
R2520:Frem1 UTSW 4 82950290 missense probably damaging 0.99
R3195:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3196:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3408:Frem1 UTSW 4 83011986 missense probably damaging 1.00
R3411:Frem1 UTSW 4 82963179 missense possibly damaging 0.51
R3742:Frem1 UTSW 4 83011867 missense probably damaging 1.00
R3829:Frem1 UTSW 4 82998930 missense probably damaging 1.00
R3888:Frem1 UTSW 4 82913607 missense probably benign 0.41
R4329:Frem1 UTSW 4 82986537 missense probably benign 0.01
R4364:Frem1 UTSW 4 82913251 missense probably damaging 0.99
R4411:Frem1 UTSW 4 82963244 missense probably damaging 1.00
R4624:Frem1 UTSW 4 82989106 missense probably damaging 1.00
R4687:Frem1 UTSW 4 83020631 missense probably damaging 1.00
R4764:Frem1 UTSW 4 82989189 missense probably damaging 1.00
R4801:Frem1 UTSW 4 82916628 splice site probably benign
R4802:Frem1 UTSW 4 82916628 splice site probably benign
R4854:Frem1 UTSW 4 82916758 missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82963150 missense probably damaging 1.00
R4947:Frem1 UTSW 4 82966134 missense probably damaging 0.99
R5007:Frem1 UTSW 4 82940812 intron probably benign
R5103:Frem1 UTSW 4 82991612 missense probably benign
R5369:Frem1 UTSW 4 83001739 missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82940753 makesense probably null
R5694:Frem1 UTSW 4 82994116 missense probably damaging 1.00
R5780:Frem1 UTSW 4 82950415 missense probably benign 0.12
R5813:Frem1 UTSW 4 83000158 missense probably damaging 1.00
R5843:Frem1 UTSW 4 82936052 missense probably damaging 1.00
R5914:Frem1 UTSW 4 83001775 missense probably damaging 1.00
R5985:Frem1 UTSW 4 82966050 missense probably benign
R6091:Frem1 UTSW 4 82900559 missense probably benign 0.01
R6165:Frem1 UTSW 4 82956255 missense probably benign 0.16
R6324:Frem1 UTSW 4 82983337 missense probably benign 0.00
R6369:Frem1 UTSW 4 82913792 splice site probably null
R6414:Frem1 UTSW 4 82940536 missense probably damaging 0.98
R6421:Frem1 UTSW 4 82994128 missense probably damaging 1.00
R6434:Frem1 UTSW 4 82966016 missense probably benign 0.03
R6453:Frem1 UTSW 4 82914825 nonsense probably null
R6598:Frem1 UTSW 4 83013828 missense probably damaging 0.99
R6720:Frem1 UTSW 4 83013832 missense probably damaging 0.98
R6862:Frem1 UTSW 4 83012014 nonsense probably null
R6922:Frem1 UTSW 4 82922269 missense probably damaging 1.00
R6931:Frem1 UTSW 4 82970677 missense probably damaging 1.00
R6992:Frem1 UTSW 4 82940362 missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82986601 missense probably damaging 1.00
R7001:Frem1 UTSW 4 82986561 missense probably benign 0.44
R7104:Frem1 UTSW 4 82940681 missense probably benign 0.30
R7146:Frem1 UTSW 4 82922295 missense possibly damaging 0.93
R7174:Frem1 UTSW 4 82922256 missense probably benign 0.00
R7327:Frem1 UTSW 4 83020755 missense possibly damaging 0.87
R7343:Frem1 UTSW 4 82994122 missense probably damaging 0.99
R7368:Frem1 UTSW 4 82966144 missense probably benign 0.19
R7392:Frem1 UTSW 4 83013827 missense probably benign 0.06
R7465:Frem1 UTSW 4 82914835 missense probably benign 0.11
R7499:Frem1 UTSW 4 83005770 missense probably damaging 1.00
R7536:Frem1 UTSW 4 82956195 missense probably damaging 1.00
R7752:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7753:Frem1 UTSW 4 82913980 missense probably benign 0.03
R7790:Frem1 UTSW 4 82989164 missense probably benign 0.02
R7818:Frem1 UTSW 4 83014008 missense probably damaging 1.00
R7877:Frem1 UTSW 4 83013812 critical splice donor site probably null
R7878:Frem1 UTSW 4 83020680 missense probably benign 0.00
R7901:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7976:Frem1 UTSW 4 83001709 missense probably damaging 0.97
R8240:Frem1 UTSW 4 82956248 missense probably benign 0.21
R8305:Frem1 UTSW 4 82999989 missense probably benign 0.06
R8415:Frem1 UTSW 4 83000262 missense probably damaging 1.00
R8751:Frem1 UTSW 4 82970778 missense probably damaging 1.00
R8819:Frem1 UTSW 4 82903517 missense probably damaging 1.00
R8820:Frem1 UTSW 4 82903517 missense probably damaging 1.00
R8829:Frem1 UTSW 4 83000194 missense probably damaging 1.00
R8834:Frem1 UTSW 4 83004373 missense probably damaging 1.00
R8910:Frem1 UTSW 4 82950457 missense probably benign 0.09
X0013:Frem1 UTSW 4 82914808 missense probably benign 0.38
X0017:Frem1 UTSW 4 82991633 critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82972267 missense probably damaging 1.00
Z1176:Frem1 UTSW 4 82999983 missense probably damaging 1.00
Z1177:Frem1 UTSW 4 82940315 critical splice donor site probably null
Z1177:Frem1 UTSW 4 83000269 missense probably benign 0.39
Z1177:Frem1 UTSW 4 83016464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAACTGCTGCTGAGTAC -3'
(R):5'- TTGAACTCTTGAAGATCTTCCTGCATC -3'

Sequencing Primer
(F):5'- CACGGAGTACACAGCATA -3'
(R):5'- GCATCTTCTTTCCAAGTGCTGGG -3'
Posted On2019-12-20