Incidental Mutation 'R7886:Ppfia1'
ID 609064
Institutional Source Beutler Lab
Gene Symbol Ppfia1
Ensembl Gene ENSMUSG00000037519
Gene Name protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Synonyms Liprin-alpha1, liprin, C030014K08Rik
MMRRC Submission 045938-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.897) question?
Stock # R7886 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 144030495-144107466 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 144073020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 265 (Q265K)
Ref Sequence ENSEMBL: ENSMUSP00000138312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168134] [ENSMUST00000182226] [ENSMUST00000182731]
AlphaFold B2RXQ2
Predicted Effect probably benign
Transcript: ENSMUST00000168134
AA Change: Q265K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126233
Gene: ENSMUSG00000037519
AA Change: Q265K

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 517 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
coiled coil region 621 667 N/A INTRINSIC
low complexity region 681 703 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 791 799 N/A INTRINSIC
SAM 884 953 5.22e-7 SMART
low complexity region 954 966 N/A INTRINSIC
SAM 999 1066 3.89e-6 SMART
SAM 1087 1159 1.14e-7 SMART
low complexity region 1207 1218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182226
AA Change: Q265K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138312
Gene: ENSMUSG00000037519
AA Change: Q265K

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 389 N/A INTRINSIC
coiled coil region 411 542 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
coiled coil region 646 692 N/A INTRINSIC
low complexity region 706 728 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 816 824 N/A INTRINSIC
SAM 909 978 5.22e-7 SMART
low complexity region 979 991 N/A INTRINSIC
SAM 1024 1091 3.89e-6 SMART
SAM 1112 1184 1.14e-7 SMART
low complexity region 1232 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182731
SMART Domains Protein: ENSMUSP00000138238
Gene: ENSMUSG00000037519

DomainStartEndE-ValueType
coiled coil region 32 67 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. This protein binds to the intracellular membrane-distal phosphatase domain of tyrosine phosphatase LAR, and appears to localize LAR to cell focal adhesions. This interaction may regulate the disassembly of focal adhesion and thus help orchestrate cell-matrix interactions. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T G 6: 92,811,437 (GRCm39) I130S unknown Het
Ano5 A G 7: 51,220,141 (GRCm39) H427R probably benign Het
Atad2 A T 15: 57,989,532 (GRCm39) V182E probably damaging Het
B4galnt1 T C 10: 127,002,923 (GRCm39) Y147H probably damaging Het
C1s2 T C 6: 124,605,289 (GRCm39) S349G possibly damaging Het
Ccdc51 G T 9: 108,920,655 (GRCm39) A181S probably damaging Het
Dcc G A 18: 72,087,939 (GRCm39) Q100* probably null Het
Dchs2 A T 3: 83,212,392 (GRCm39) I2064F probably damaging Het
Depdc1a G A 3: 159,221,706 (GRCm39) V217I probably benign Het
Dnajc7 A T 11: 100,492,629 (GRCm39) F31I probably benign Het
Eftud2 C T 11: 102,730,934 (GRCm39) R825H probably damaging Het
Fam184a T C 10: 53,551,256 (GRCm39) E237G probably damaging Het
Fdx2 A T 9: 20,984,623 (GRCm39) probably null Het
Frem1 T C 4: 82,934,643 (GRCm39) D106G possibly damaging Het
Gabrg3 G A 7: 56,374,229 (GRCm39) R446W probably damaging Het
Get1 T A 16: 95,946,768 (GRCm39) L31Q possibly damaging Het
Gm42669 A G 5: 107,656,572 (GRCm39) E362G Het
Hmcn1 A T 1: 150,533,221 (GRCm39) I3022N possibly damaging Het
Ifna2 C A 4: 88,601,506 (GRCm39) V171F probably damaging Het
Igsf10 T C 3: 59,235,748 (GRCm39) N1478D probably benign Het
Kcnc1 C A 7: 46,077,045 (GRCm39) D282E probably damaging Het
Klhdc2 G A 12: 69,351,406 (GRCm39) probably null Het
Macrod2 G A 2: 141,566,565 (GRCm39) G188S probably damaging Het
Mapkbp1 T C 2: 119,843,128 (GRCm39) F186L possibly damaging Het
Mettl21a T C 1: 64,654,343 (GRCm39) E58G probably damaging Het
Muc16 A T 9: 18,497,278 (GRCm39) C6625S probably benign Het
Naip5 A T 13: 100,382,689 (GRCm39) S7T probably benign Het
Nfs1 T A 2: 155,983,981 (GRCm39) D132V unknown Het
Nlgn1 T C 3: 25,490,071 (GRCm39) D552G probably damaging Het
Numa1 C T 7: 101,663,072 (GRCm39) T2066I probably benign Het
Or10k2 T C 8: 84,268,576 (GRCm39) S268P possibly damaging Het
Or2t48 C A 11: 58,419,880 (GRCm39) V311L probably benign Het
Or4k2 A T 14: 50,424,021 (GRCm39) Y219N probably damaging Het
Or7a39 A G 10: 78,715,657 (GRCm39) Y217C possibly damaging Het
Or7g29 A T 9: 19,287,202 (GRCm39) probably null Het
Pde11a C T 2: 76,121,547 (GRCm39) V345I probably benign Het
Pglyrp2 A G 17: 32,637,735 (GRCm39) S98P possibly damaging Het
Pik3c3 C T 18: 30,452,641 (GRCm39) Q643* probably null Het
Pold2 T C 11: 5,822,714 (GRCm39) Y402C probably damaging Het
Pom121 T C 5: 135,410,848 (GRCm39) T770A unknown Het
Pou4f1 A T 14: 104,704,228 (GRCm39) V68E probably damaging Het
Pygl A G 12: 70,253,130 (GRCm39) probably null Het
Rdh19 A G 10: 127,686,169 (GRCm39) T94A probably benign Het
Scgb1b12 A G 7: 32,033,922 (GRCm39) T61A probably damaging Het
Sirpb1c C T 3: 15,886,366 (GRCm39) A337T probably benign Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Tbc1d23 T C 16: 57,009,746 (GRCm39) E381G possibly damaging Het
Tnik A G 3: 28,720,288 (GRCm39) I1304V probably damaging Het
Tpmt C A 13: 47,193,638 (GRCm39) G54C probably damaging Het
Usp25 A T 16: 76,910,659 (GRCm39) Q905L probably damaging Het
Vmn1r91 T A 7: 19,835,490 (GRCm39) N136K probably benign Het
Wdr70 C T 15: 8,108,733 (GRCm39) E138K probably benign Het
Zbed3 A G 13: 95,472,633 (GRCm39) D19G possibly damaging Het
Zfp369 A G 13: 65,439,868 (GRCm39) K184R possibly damaging Het
Other mutations in Ppfia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Ppfia1 APN 7 144,035,456 (GRCm39) missense probably benign 0.00
IGL01771:Ppfia1 APN 7 144,036,094 (GRCm39) missense probably benign 0.36
IGL02220:Ppfia1 APN 7 144,035,512 (GRCm39) missense probably damaging 1.00
IGL02683:Ppfia1 APN 7 144,067,095 (GRCm39) missense probably damaging 0.99
IGL02752:Ppfia1 APN 7 144,073,341 (GRCm39) missense probably benign
PIT1430001:Ppfia1 UTSW 7 144,052,073 (GRCm39) missense probably damaging 1.00
R0081:Ppfia1 UTSW 7 144,058,711 (GRCm39) missense probably damaging 1.00
R0304:Ppfia1 UTSW 7 144,036,082 (GRCm39) missense probably damaging 1.00
R0359:Ppfia1 UTSW 7 144,038,929 (GRCm39) missense probably damaging 0.97
R1836:Ppfia1 UTSW 7 144,073,368 (GRCm39) missense probably benign 0.19
R1934:Ppfia1 UTSW 7 144,058,847 (GRCm39) missense probably benign 0.12
R2195:Ppfia1 UTSW 7 144,069,844 (GRCm39) missense probably damaging 1.00
R3759:Ppfia1 UTSW 7 144,069,739 (GRCm39) missense probably benign 0.34
R3843:Ppfia1 UTSW 7 144,058,707 (GRCm39) missense probably benign 0.31
R4606:Ppfia1 UTSW 7 144,038,929 (GRCm39) missense probably damaging 0.97
R4820:Ppfia1 UTSW 7 144,052,106 (GRCm39) missense probably benign 0.33
R4898:Ppfia1 UTSW 7 144,045,313 (GRCm39) missense probably damaging 1.00
R5069:Ppfia1 UTSW 7 144,068,210 (GRCm39) nonsense probably null
R5070:Ppfia1 UTSW 7 144,068,210 (GRCm39) nonsense probably null
R5076:Ppfia1 UTSW 7 144,060,001 (GRCm39) missense probably damaging 1.00
R5280:Ppfia1 UTSW 7 144,038,832 (GRCm39) missense possibly damaging 0.84
R5473:Ppfia1 UTSW 7 144,045,229 (GRCm39) missense probably benign 0.17
R5656:Ppfia1 UTSW 7 144,073,711 (GRCm39) critical splice donor site probably null
R5818:Ppfia1 UTSW 7 144,074,305 (GRCm39) intron probably benign
R6104:Ppfia1 UTSW 7 144,045,311 (GRCm39) missense possibly damaging 0.95
R6299:Ppfia1 UTSW 7 144,064,049 (GRCm39) missense probably benign 0.11
R6474:Ppfia1 UTSW 7 144,059,942 (GRCm39) missense possibly damaging 0.89
R6705:Ppfia1 UTSW 7 144,072,911 (GRCm39) missense possibly damaging 0.93
R6734:Ppfia1 UTSW 7 144,032,790 (GRCm39) missense probably damaging 1.00
R7062:Ppfia1 UTSW 7 144,106,210 (GRCm39) missense probably benign
R7451:Ppfia1 UTSW 7 144,061,947 (GRCm39) missense probably benign
R7514:Ppfia1 UTSW 7 144,071,450 (GRCm39) missense probably benign 0.01
R7552:Ppfia1 UTSW 7 144,059,982 (GRCm39) missense probably damaging 1.00
R7633:Ppfia1 UTSW 7 144,106,173 (GRCm39) missense possibly damaging 0.89
R8038:Ppfia1 UTSW 7 144,068,653 (GRCm39) missense possibly damaging 0.67
R8139:Ppfia1 UTSW 7 144,074,430 (GRCm39) missense probably damaging 1.00
R8266:Ppfia1 UTSW 7 144,068,231 (GRCm39) missense possibly damaging 0.72
R8859:Ppfia1 UTSW 7 144,032,762 (GRCm39) critical splice donor site probably null
R9621:Ppfia1 UTSW 7 144,052,516 (GRCm39) missense probably damaging 1.00
R9722:Ppfia1 UTSW 7 144,071,402 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGCCAAAGGTTCCAGACTATG -3'
(R):5'- TGTTGGGGAATAGTGGCAAC -3'

Sequencing Primer
(F):5'- CCAAAGGTTCCAGACTATGAGAGC -3'
(R):5'- GCAACTAAGGTGTGTGTCCAC -3'
Posted On 2019-12-20