Incidental Mutation 'R7886:Ccdc51'
ID609068
Institutional Source Beutler Lab
Gene Symbol Ccdc51
Ensembl Gene ENSMUSG00000025645
Gene Namecoiled-coil domain containing 51
Synonyms5730568A12Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R7886 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109082493-109092489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109091587 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 181 (A181S)
Ref Sequence ENSEMBL: ENSMUSP00000026735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026735] [ENSMUST00000072093] [ENSMUST00000131462]
Predicted Effect probably damaging
Transcript: ENSMUST00000026735
AA Change: A181S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026735
Gene: ENSMUSG00000025645
AA Change: A181S

DomainStartEndE-ValueType
coiled coil region 109 162 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
low complexity region 274 286 N/A INTRINSIC
transmembrane domain 381 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072093
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131462
SMART Domains Protein: ENSMUSP00000115265
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T G 6: 92,834,456 I130S unknown Het
Ano5 A G 7: 51,570,393 H427R probably benign Het
Atad2 A T 15: 58,126,136 V182E probably damaging Het
B4galnt1 T C 10: 127,167,054 Y147H probably damaging Het
C1s2 T C 6: 124,628,330 S349G possibly damaging Het
Dcc G A 18: 71,954,868 Q100* probably null Het
Dchs2 A T 3: 83,305,085 I2064F probably damaging Het
Depdc1a G A 3: 159,516,069 V217I probably benign Het
Dnajc7 A T 11: 100,601,803 F31I probably benign Het
Eftud2 C T 11: 102,840,108 R825H probably damaging Het
Fam184a T C 10: 53,675,160 E237G probably damaging Het
Fdx1l A T 9: 21,073,327 probably null Het
Frem1 T C 4: 83,016,406 D106G possibly damaging Het
Gabrg3 G A 7: 56,724,481 R446W probably damaging Het
Gm42669 A G 5: 107,508,706 E362G Het
Hmcn1 A T 1: 150,657,470 I3022N possibly damaging Het
Ifna2 C A 4: 88,683,269 V171F probably damaging Het
Igsf10 T C 3: 59,328,327 N1478D probably benign Het
Kcnc1 C A 7: 46,427,621 D282E probably damaging Het
Klhdc2 G A 12: 69,304,632 probably null Het
Macrod2 G A 2: 141,724,645 G188S probably damaging Het
Mapkbp1 T C 2: 120,012,647 F186L possibly damaging Het
Mettl21a T C 1: 64,615,184 E58G probably damaging Het
Muc16 A T 9: 18,585,982 C6625S probably benign Het
Naip5 A T 13: 100,246,181 S7T probably benign Het
Nfs1 T A 2: 156,142,061 D132V unknown Het
Nlgn1 T C 3: 25,435,907 D552G probably damaging Het
Numa1 C T 7: 102,013,865 T2066I probably benign Het
Olfr1355 A G 10: 78,879,823 Y217C possibly damaging Het
Olfr330 C A 11: 58,529,054 V311L probably benign Het
Olfr370 T C 8: 83,541,947 S268P possibly damaging Het
Olfr730 A T 14: 50,186,564 Y219N probably damaging Het
Olfr847 A T 9: 19,375,906 probably null Het
Pde11a C T 2: 76,291,203 V345I probably benign Het
Pglyrp2 A G 17: 32,418,761 S98P possibly damaging Het
Pik3c3 C T 18: 30,319,588 Q643* probably null Het
Pold2 T C 11: 5,872,714 Y402C probably damaging Het
Pom121 T C 5: 135,381,994 T770A unknown Het
Pou4f1 A T 14: 104,466,792 V68E probably damaging Het
Ppfia1 G T 7: 144,519,283 Q265K probably benign Het
Pygl A G 12: 70,206,356 probably null Het
Rdh19 A G 10: 127,850,300 T94A probably benign Het
Scgb1b12 A G 7: 32,334,497 T61A probably damaging Het
Sirpb1c C T 3: 15,832,202 A337T probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tbc1d23 T C 16: 57,189,383 E381G possibly damaging Het
Tnik A G 3: 28,666,139 I1304V probably damaging Het
Tpmt C A 13: 47,040,162 G54C probably damaging Het
Usp25 A T 16: 77,113,771 Q905L probably damaging Het
Vmn1r91 T A 7: 20,101,565 N136K probably benign Het
Wdr70 C T 15: 8,079,249 E138K probably benign Het
Wrb T A 16: 96,145,568 L31Q possibly damaging Het
Zbed3 A G 13: 95,336,125 D19G possibly damaging Het
Zfp369 A G 13: 65,292,054 K184R possibly damaging Het
Other mutations in Ccdc51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Ccdc51 APN 9 109092184 missense probably damaging 1.00
IGL02615:Ccdc51 APN 9 109089435 missense probably benign
IGL02806:Ccdc51 APN 9 109092248 missense probably benign 0.00
R0100:Ccdc51 UTSW 9 109091998 nonsense probably null
R0137:Ccdc51 UTSW 9 109091630 missense probably damaging 1.00
R0211:Ccdc51 UTSW 9 109089373 missense probably benign 0.01
R0211:Ccdc51 UTSW 9 109089373 missense probably benign 0.01
R4540:Ccdc51 UTSW 9 109092220 missense possibly damaging 0.50
R4669:Ccdc51 UTSW 9 109090962 missense probably benign 0.00
R4770:Ccdc51 UTSW 9 109090910 missense probably benign
R5364:Ccdc51 UTSW 9 109092120 missense possibly damaging 0.82
R6137:Ccdc51 UTSW 9 109089415 missense probably benign 0.21
R7146:Ccdc51 UTSW 9 109091780 missense probably damaging 1.00
R7831:Ccdc51 UTSW 9 109091990 missense probably damaging 1.00
Z1176:Ccdc51 UTSW 9 109092148 nonsense probably null
Z1176:Ccdc51 UTSW 9 109092226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGGTGTTTGTAGAGCC -3'
(R):5'- GAGGGAATAGCTAGAAGCCTGTTC -3'

Sequencing Primer
(F):5'- CTGTGGCAGGGGAGTGTCC -3'
(R):5'- CTAGAAGCCTGTTCACGGATG -3'
Posted On2019-12-20