Incidental Mutation 'R7886:Eftud2'
ID 609076
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Name elongation factor Tu GTP binding domain containing 2
Synonyms 116kDa, Snrp116, U5-116kD
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7886 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102838473-102880985 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 102840108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 825 (R825H)
Ref Sequence ENSEMBL: ENSMUSP00000102675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021302] [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000107072] [ENSMUST00000107073] [ENSMUST00000173679]
AlphaFold O08810
Predicted Effect probably benign
Transcript: ENSMUST00000021302
SMART Domains Protein: ENSMUSP00000021302
Gene: ENSMUSG00000020928

DomainStartEndE-ValueType
Pfam:HIG_1_N 25 79 1.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021306
AA Change: R826H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929
AA Change: R826H

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107060
AA Change: R825H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929
AA Change: R825H

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107072
SMART Domains Protein: ENSMUSP00000102687
Gene: ENSMUSG00000020928

DomainStartEndE-ValueType
Pfam:HIG_1_N 25 79 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107073
SMART Domains Protein: ENSMUSP00000102688
Gene: ENSMUSG00000020928

DomainStartEndE-ValueType
Pfam:HIG_1_N 25 79 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132543
SMART Domains Protein: ENSMUSP00000133732
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFG_IV 1 65 2.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172611
SMART Domains Protein: ENSMUSP00000134316
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 85 98 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173679
AA Change: R816H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929
AA Change: R816H

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Meta Mutation Damage Score 0.9478 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T G 6: 92,834,456 I130S unknown Het
Ano5 A G 7: 51,570,393 H427R probably benign Het
Atad2 A T 15: 58,126,136 V182E probably damaging Het
B4galnt1 T C 10: 127,167,054 Y147H probably damaging Het
C1s2 T C 6: 124,628,330 S349G possibly damaging Het
Ccdc51 G T 9: 109,091,587 A181S probably damaging Het
Dcc G A 18: 71,954,868 Q100* probably null Het
Dchs2 A T 3: 83,305,085 I2064F probably damaging Het
Depdc1a G A 3: 159,516,069 V217I probably benign Het
Dnajc7 A T 11: 100,601,803 F31I probably benign Het
Fam184a T C 10: 53,675,160 E237G probably damaging Het
Fdx1l A T 9: 21,073,327 probably null Het
Frem1 T C 4: 83,016,406 D106G possibly damaging Het
Gabrg3 G A 7: 56,724,481 R446W probably damaging Het
Gm42669 A G 5: 107,508,706 E362G Het
Hmcn1 A T 1: 150,657,470 I3022N possibly damaging Het
Ifna2 C A 4: 88,683,269 V171F probably damaging Het
Igsf10 T C 3: 59,328,327 N1478D probably benign Het
Kcnc1 C A 7: 46,427,621 D282E probably damaging Het
Klhdc2 G A 12: 69,304,632 probably null Het
Macrod2 G A 2: 141,724,645 G188S probably damaging Het
Mapkbp1 T C 2: 120,012,647 F186L possibly damaging Het
Mettl21a T C 1: 64,615,184 E58G probably damaging Het
Muc16 A T 9: 18,585,982 C6625S probably benign Het
Naip5 A T 13: 100,246,181 S7T probably benign Het
Nfs1 T A 2: 156,142,061 D132V unknown Het
Nlgn1 T C 3: 25,435,907 D552G probably damaging Het
Numa1 C T 7: 102,013,865 T2066I probably benign Het
Olfr1355 A G 10: 78,879,823 Y217C possibly damaging Het
Olfr330 C A 11: 58,529,054 V311L probably benign Het
Olfr370 T C 8: 83,541,947 S268P possibly damaging Het
Olfr730 A T 14: 50,186,564 Y219N probably damaging Het
Olfr847 A T 9: 19,375,906 probably null Het
Pde11a C T 2: 76,291,203 V345I probably benign Het
Pglyrp2 A G 17: 32,418,761 S98P possibly damaging Het
Pik3c3 C T 18: 30,319,588 Q643* probably null Het
Pold2 T C 11: 5,872,714 Y402C probably damaging Het
Pom121 T C 5: 135,381,994 T770A unknown Het
Pou4f1 A T 14: 104,466,792 V68E probably damaging Het
Ppfia1 G T 7: 144,519,283 Q265K probably benign Het
Pygl A G 12: 70,206,356 probably null Het
Rdh19 A G 10: 127,850,300 T94A probably benign Het
Scgb1b12 A G 7: 32,334,497 T61A probably damaging Het
Sirpb1c C T 3: 15,832,202 A337T probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tbc1d23 T C 16: 57,189,383 E381G possibly damaging Het
Tnik A G 3: 28,666,139 I1304V probably damaging Het
Tpmt C A 13: 47,040,162 G54C probably damaging Het
Usp25 A T 16: 77,113,771 Q905L probably damaging Het
Vmn1r91 T A 7: 20,101,565 N136K probably benign Het
Wdr70 C T 15: 8,079,249 E138K probably benign Het
Wrb T A 16: 96,145,568 L31Q possibly damaging Het
Zbed3 A G 13: 95,336,125 D19G possibly damaging Het
Zfp369 A G 13: 65,292,054 K184R possibly damaging Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102865563 splice site probably benign
IGL01765:Eftud2 APN 11 102839256 missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102869127 missense probably benign 0.08
IGL02161:Eftud2 APN 11 102854876 splice site probably benign
IGL02165:Eftud2 APN 11 102851747 splice site probably benign
IGL02218:Eftud2 APN 11 102870213 missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102851754 splice site probably null
IGL02664:Eftud2 APN 11 102841712 missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102846614 missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102870256 splice site probably benign
IGL02870:Eftud2 APN 11 102862626 missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102870183 missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102868617 missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102864725 missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102864801 splice site probably benign
R0463:Eftud2 UTSW 11 102864771 missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102844222 missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102846620 missense probably damaging 1.00
R0751:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R1034:Eftud2 UTSW 11 102849184 missense probably benign
R1079:Eftud2 UTSW 11 102840044 nonsense probably null
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1220:Eftud2 UTSW 11 102851747 splice site probably benign
R1438:Eftud2 UTSW 11 102860042 missense probably damaging 1.00
R1520:Eftud2 UTSW 11 102839440 missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102854771 splice site probably benign
R2270:Eftud2 UTSW 11 102864781 missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102844180 missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3687:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3808:Eftud2 UTSW 11 102841463 splice site probably null
R3892:Eftud2 UTSW 11 102846187 missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102860110 missense possibly damaging 0.51
R4091:Eftud2 UTSW 11 102839416 splice site probably null
R4794:Eftud2 UTSW 11 102870177 missense probably benign 0.14
R4841:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R5151:Eftud2 UTSW 11 102867844 critical splice donor site probably null
R5208:Eftud2 UTSW 11 102841185 missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102840057 missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102864780 missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102838623 nonsense probably null
R7604:Eftud2 UTSW 11 102848012 missense possibly damaging 0.87
R8017:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8019:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8139:Eftud2 UTSW 11 102867859 missense probably benign 0.04
R8431:Eftud2 UTSW 11 102846236 missense probably benign 0.08
R8545:Eftud2 UTSW 11 102840271 missense probably damaging 1.00
R8676:Eftud2 UTSW 11 102868621 missense probably damaging 1.00
R9089:Eftud2 UTSW 11 102869145 missense probably benign
R9173:Eftud2 UTSW 11 102843416 missense probably damaging 1.00
R9277:Eftud2 UTSW 11 102860029 missense probably damaging 1.00
R9313:Eftud2 UTSW 11 102839436 missense probably benign 0.03
R9604:Eftud2 UTSW 11 102846230 missense probably benign 0.11
R9664:Eftud2 UTSW 11 102868596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAACTGTAGCCACTGCCTGTG -3'
(R):5'- TGCCTTCCTCATGGTAAGTGG -3'

Sequencing Primer
(F):5'- GTAGGAGTGCCTCAGCTCATTAC -3'
(R):5'- CTTCCTCATGGTAAGTGGAGTTATAG -3'
Posted On 2019-12-20