Incidental Mutation 'R7886:Tbc1d23'
ID 609085
Institutional Source Beutler Lab
Gene Symbol Tbc1d23
Ensembl Gene ENSMUSG00000022749
Gene Name TBC1 domain family, member 23
Synonyms 4930451A13Rik, D030022P07Rik
MMRRC Submission 045938-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.788) question?
Stock # R7886 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 56989225-57051867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57009746 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 381 (E381G)
Ref Sequence ENSEMBL: ENSMUSP00000023431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023431] [ENSMUST00000226586]
AlphaFold Q8K0F1
Predicted Effect possibly damaging
Transcript: ENSMUST00000023431
AA Change: E381G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023431
Gene: ENSMUSG00000022749
AA Change: E381G

DomainStartEndE-ValueType
TBC 41 249 7.22e-5 SMART
RHOD 323 443 7.83e-1 SMART
low complexity region 459 472 N/A INTRINSIC
Blast:TBC 506 630 8e-14 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000226586
AA Change: E381G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.0764 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased serum cytokine production and inflammatory cells in the peritoneum following i.p. lipopolysaccharide injection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T G 6: 92,811,437 (GRCm39) I130S unknown Het
Ano5 A G 7: 51,220,141 (GRCm39) H427R probably benign Het
Atad2 A T 15: 57,989,532 (GRCm39) V182E probably damaging Het
B4galnt1 T C 10: 127,002,923 (GRCm39) Y147H probably damaging Het
C1s2 T C 6: 124,605,289 (GRCm39) S349G possibly damaging Het
Ccdc51 G T 9: 108,920,655 (GRCm39) A181S probably damaging Het
Dcc G A 18: 72,087,939 (GRCm39) Q100* probably null Het
Dchs2 A T 3: 83,212,392 (GRCm39) I2064F probably damaging Het
Depdc1a G A 3: 159,221,706 (GRCm39) V217I probably benign Het
Dnajc7 A T 11: 100,492,629 (GRCm39) F31I probably benign Het
Eftud2 C T 11: 102,730,934 (GRCm39) R825H probably damaging Het
Fam184a T C 10: 53,551,256 (GRCm39) E237G probably damaging Het
Fdx2 A T 9: 20,984,623 (GRCm39) probably null Het
Frem1 T C 4: 82,934,643 (GRCm39) D106G possibly damaging Het
Gabrg3 G A 7: 56,374,229 (GRCm39) R446W probably damaging Het
Get1 T A 16: 95,946,768 (GRCm39) L31Q possibly damaging Het
Gm42669 A G 5: 107,656,572 (GRCm39) E362G Het
Hmcn1 A T 1: 150,533,221 (GRCm39) I3022N possibly damaging Het
Ifna2 C A 4: 88,601,506 (GRCm39) V171F probably damaging Het
Igsf10 T C 3: 59,235,748 (GRCm39) N1478D probably benign Het
Kcnc1 C A 7: 46,077,045 (GRCm39) D282E probably damaging Het
Klhdc2 G A 12: 69,351,406 (GRCm39) probably null Het
Macrod2 G A 2: 141,566,565 (GRCm39) G188S probably damaging Het
Mapkbp1 T C 2: 119,843,128 (GRCm39) F186L possibly damaging Het
Mettl21a T C 1: 64,654,343 (GRCm39) E58G probably damaging Het
Muc16 A T 9: 18,497,278 (GRCm39) C6625S probably benign Het
Naip5 A T 13: 100,382,689 (GRCm39) S7T probably benign Het
Nfs1 T A 2: 155,983,981 (GRCm39) D132V unknown Het
Nlgn1 T C 3: 25,490,071 (GRCm39) D552G probably damaging Het
Numa1 C T 7: 101,663,072 (GRCm39) T2066I probably benign Het
Or10k2 T C 8: 84,268,576 (GRCm39) S268P possibly damaging Het
Or2t48 C A 11: 58,419,880 (GRCm39) V311L probably benign Het
Or4k2 A T 14: 50,424,021 (GRCm39) Y219N probably damaging Het
Or7a39 A G 10: 78,715,657 (GRCm39) Y217C possibly damaging Het
Or7g29 A T 9: 19,287,202 (GRCm39) probably null Het
Pde11a C T 2: 76,121,547 (GRCm39) V345I probably benign Het
Pglyrp2 A G 17: 32,637,735 (GRCm39) S98P possibly damaging Het
Pik3c3 C T 18: 30,452,641 (GRCm39) Q643* probably null Het
Pold2 T C 11: 5,822,714 (GRCm39) Y402C probably damaging Het
Pom121 T C 5: 135,410,848 (GRCm39) T770A unknown Het
Pou4f1 A T 14: 104,704,228 (GRCm39) V68E probably damaging Het
Ppfia1 G T 7: 144,073,020 (GRCm39) Q265K probably benign Het
Pygl A G 12: 70,253,130 (GRCm39) probably null Het
Rdh19 A G 10: 127,686,169 (GRCm39) T94A probably benign Het
Scgb1b12 A G 7: 32,033,922 (GRCm39) T61A probably damaging Het
Sirpb1c C T 3: 15,886,366 (GRCm39) A337T probably benign Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Tnik A G 3: 28,720,288 (GRCm39) I1304V probably damaging Het
Tpmt C A 13: 47,193,638 (GRCm39) G54C probably damaging Het
Usp25 A T 16: 76,910,659 (GRCm39) Q905L probably damaging Het
Vmn1r91 T A 7: 19,835,490 (GRCm39) N136K probably benign Het
Wdr70 C T 15: 8,108,733 (GRCm39) E138K probably benign Het
Zbed3 A G 13: 95,472,633 (GRCm39) D19G possibly damaging Het
Zfp369 A G 13: 65,439,868 (GRCm39) K184R possibly damaging Het
Other mutations in Tbc1d23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tbc1d23 APN 16 56,992,139 (GRCm39) missense probably damaging 1.00
IGL01063:Tbc1d23 APN 16 57,013,038 (GRCm39) missense probably benign 0.04
IGL01951:Tbc1d23 APN 16 57,007,048 (GRCm39) splice site probably benign
IGL01980:Tbc1d23 APN 16 57,009,615 (GRCm39) splice site probably benign
IGL02457:Tbc1d23 APN 16 56,990,754 (GRCm39) missense probably damaging 1.00
IGL02937:Tbc1d23 APN 16 57,004,778 (GRCm39) missense possibly damaging 0.94
IGL03226:Tbc1d23 APN 16 57,034,625 (GRCm39) missense probably damaging 1.00
R0386:Tbc1d23 UTSW 16 57,009,636 (GRCm39) missense probably damaging 1.00
R0472:Tbc1d23 UTSW 16 56,993,469 (GRCm39) missense possibly damaging 0.74
R0479:Tbc1d23 UTSW 16 56,992,177 (GRCm39) missense probably damaging 1.00
R0609:Tbc1d23 UTSW 16 56,993,469 (GRCm39) missense possibly damaging 0.74
R1124:Tbc1d23 UTSW 16 57,034,525 (GRCm39) critical splice donor site probably null
R1430:Tbc1d23 UTSW 16 57,034,573 (GRCm39) missense probably damaging 1.00
R1797:Tbc1d23 UTSW 16 56,993,463 (GRCm39) missense possibly damaging 0.90
R1978:Tbc1d23 UTSW 16 57,009,714 (GRCm39) missense probably benign
R4675:Tbc1d23 UTSW 16 57,003,325 (GRCm39) missense possibly damaging 0.72
R4756:Tbc1d23 UTSW 16 57,019,258 (GRCm39) frame shift probably null
R4781:Tbc1d23 UTSW 16 57,038,778 (GRCm39) missense possibly damaging 0.87
R4799:Tbc1d23 UTSW 16 57,012,991 (GRCm39) missense probably benign 0.01
R4895:Tbc1d23 UTSW 16 57,019,220 (GRCm39) critical splice donor site probably null
R5389:Tbc1d23 UTSW 16 57,019,291 (GRCm39) missense probably damaging 1.00
R5601:Tbc1d23 UTSW 16 57,018,672 (GRCm39) missense probably benign 0.02
R6041:Tbc1d23 UTSW 16 56,993,513 (GRCm39) missense probably benign 0.14
R6176:Tbc1d23 UTSW 16 56,992,152 (GRCm39) missense probably damaging 1.00
R6195:Tbc1d23 UTSW 16 57,051,713 (GRCm39) missense possibly damaging 0.56
R6228:Tbc1d23 UTSW 16 57,003,266 (GRCm39) missense probably damaging 0.98
R6232:Tbc1d23 UTSW 16 56,990,796 (GRCm39) missense probably benign 0.39
R6484:Tbc1d23 UTSW 16 56,998,379 (GRCm39) missense probably damaging 1.00
R6670:Tbc1d23 UTSW 16 57,034,580 (GRCm39) missense probably benign 0.00
R6957:Tbc1d23 UTSW 16 57,028,686 (GRCm39) missense probably damaging 1.00
R7218:Tbc1d23 UTSW 16 56,990,745 (GRCm39) missense probably damaging 1.00
R7601:Tbc1d23 UTSW 16 57,001,897 (GRCm39) missense probably benign 0.10
R7877:Tbc1d23 UTSW 16 56,993,488 (GRCm39) missense probably benign 0.35
R8202:Tbc1d23 UTSW 16 57,011,917 (GRCm39) missense probably damaging 1.00
R8927:Tbc1d23 UTSW 16 56,992,152 (GRCm39) missense probably damaging 1.00
R8928:Tbc1d23 UTSW 16 56,992,152 (GRCm39) missense probably damaging 1.00
R9240:Tbc1d23 UTSW 16 57,032,748 (GRCm39) missense possibly damaging 0.89
R9405:Tbc1d23 UTSW 16 57,012,985 (GRCm39) missense possibly damaging 0.91
R9522:Tbc1d23 UTSW 16 57,019,107 (GRCm39) missense probably benign 0.37
R9772:Tbc1d23 UTSW 16 56,990,765 (GRCm39) missense probably damaging 1.00
Z1177:Tbc1d23 UTSW 16 57,003,338 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTTCTCCACGGTGTCAGCC -3'
(R):5'- CAGTTCTTCCTTCTGATTGAGGAG -3'

Sequencing Primer
(F):5'- ACGGTGTCAGCCACGAG -3'
(R):5'- GAGGAGTGTTTGTCTCAGCC -3'
Posted On 2019-12-20