Incidental Mutation 'R7887:Sphkap'
ID609092
Institutional Source Beutler Lab
Gene Symbol Sphkap
Ensembl Gene ENSMUSG00000026163
Gene NameSPHK1 interactor, AKAP domain containing
Synonyms4930544G21Rik, A930009L15Rik, SKIP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7887 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location83254139-83408200 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83277412 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 872 (Y872C)
Ref Sequence ENSEMBL: ENSMUSP00000124872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]
Predicted Effect probably benign
Transcript: ENSMUST00000159078
AA Change: Y585C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: Y585C

DomainStartEndE-ValueType
low complexity region 303 314 N/A INTRINSIC
SCOP:d1ash__ 382 462 5e-3 SMART
low complexity region 809 819 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
low complexity region 1202 1221 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
Pfam:AKAP_110 1281 1398 7.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160953
AA Change: Y872C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: Y872C

DomainStartEndE-ValueType
low complexity region 590 601 N/A INTRINSIC
SCOP:d1ash__ 669 749 6e-3 SMART
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1489 1508 N/A INTRINSIC
Pfam:AKAP_110 1540 1655 6.4e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Sphkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sphkap APN 1 83280516 missense probably damaging 1.00
IGL00337:Sphkap APN 1 83339608 missense probably damaging 1.00
IGL00470:Sphkap APN 1 83277910 missense possibly damaging 0.87
IGL00577:Sphkap APN 1 83278844 missense probably damaging 1.00
IGL00657:Sphkap APN 1 83276375 missense probably damaging 1.00
IGL01868:Sphkap APN 1 83280399 splice site probably null
IGL02101:Sphkap APN 1 83290987 missense probably damaging 1.00
IGL02471:Sphkap APN 1 83276176 missense probably damaging 1.00
IGL02943:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL02945:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03008:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03031:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03059:Sphkap APN 1 83257242 missense probably damaging 0.97
IGL03085:Sphkap APN 1 83280354 missense possibly damaging 0.92
IGL03355:Sphkap APN 1 83280503 missense probably damaging 1.00
IGL03356:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03368:Sphkap APN 1 83275676 missense probably benign 0.14
R0294:Sphkap UTSW 1 83278245 missense possibly damaging 0.72
R0308:Sphkap UTSW 1 83276969 missense probably damaging 1.00
R0478:Sphkap UTSW 1 83278711 missense probably damaging 1.00
R0606:Sphkap UTSW 1 83280424 missense probably damaging 1.00
R0678:Sphkap UTSW 1 83278628 missense probably benign 0.03
R1216:Sphkap UTSW 1 83290977 missense probably damaging 1.00
R1253:Sphkap UTSW 1 83278898 missense possibly damaging 0.56
R1532:Sphkap UTSW 1 83257203 missense probably damaging 1.00
R1635:Sphkap UTSW 1 83278400 missense probably benign 0.03
R1655:Sphkap UTSW 1 83277515 nonsense probably null
R1657:Sphkap UTSW 1 83277515 nonsense probably null
R1700:Sphkap UTSW 1 83277515 nonsense probably null
R1701:Sphkap UTSW 1 83277515 nonsense probably null
R1734:Sphkap UTSW 1 83277515 nonsense probably null
R1736:Sphkap UTSW 1 83277515 nonsense probably null
R1743:Sphkap UTSW 1 83277515 nonsense probably null
R1744:Sphkap UTSW 1 83277515 nonsense probably null
R1760:Sphkap UTSW 1 83277544 missense probably benign 0.29
R1893:Sphkap UTSW 1 83278966 missense probably benign 0.02
R1937:Sphkap UTSW 1 83267441 nonsense probably null
R1986:Sphkap UTSW 1 83277922 missense probably damaging 1.00
R1993:Sphkap UTSW 1 83277515 nonsense probably null
R1995:Sphkap UTSW 1 83277515 nonsense probably null
R2001:Sphkap UTSW 1 83276662 missense probably damaging 1.00
R2004:Sphkap UTSW 1 83277911 missense probably benign 0.04
R2111:Sphkap UTSW 1 83275881 missense probably benign 0.00
R2112:Sphkap UTSW 1 83275881 missense probably benign 0.00
R2156:Sphkap UTSW 1 83277989 missense probably benign 0.03
R2182:Sphkap UTSW 1 83276684 missense probably damaging 1.00
R2271:Sphkap UTSW 1 83257221 missense probably damaging 1.00
R3712:Sphkap UTSW 1 83277112 missense probably benign 0.27
R3919:Sphkap UTSW 1 83276458 missense probably damaging 1.00
R3980:Sphkap UTSW 1 83267494 splice site probably null
R4130:Sphkap UTSW 1 83277898 missense probably damaging 0.96
R4539:Sphkap UTSW 1 83277793 missense probably benign 0.00
R4602:Sphkap UTSW 1 83279061 nonsense probably null
R4735:Sphkap UTSW 1 83279117 missense probably benign 0.01
R4793:Sphkap UTSW 1 83278084 missense possibly damaging 0.77
R4849:Sphkap UTSW 1 83277384 missense probably benign 0.03
R4880:Sphkap UTSW 1 83288817 missense probably damaging 1.00
R5213:Sphkap UTSW 1 83280503 missense probably damaging 1.00
R5277:Sphkap UTSW 1 83276164 missense probably benign 0.04
R5331:Sphkap UTSW 1 83276782 missense probably benign 0.08
R5632:Sphkap UTSW 1 83278285 missense probably benign 0.01
R5647:Sphkap UTSW 1 83407999 missense probably damaging 0.98
R5751:Sphkap UTSW 1 83275897 missense probably benign 0.27
R5935:Sphkap UTSW 1 83339599 missense probably damaging 1.00
R5999:Sphkap UTSW 1 83267405 missense probably benign 0.02
R6232:Sphkap UTSW 1 83280479 missense probably damaging 1.00
R6318:Sphkap UTSW 1 83278378 missense probably damaging 1.00
R6474:Sphkap UTSW 1 83278823 missense probably damaging 1.00
R6602:Sphkap UTSW 1 83275758 missense possibly damaging 0.75
R6674:Sphkap UTSW 1 83277834 missense probably benign 0.37
R6716:Sphkap UTSW 1 83362228 critical splice donor site probably null
R6803:Sphkap UTSW 1 83280510 missense probably damaging 1.00
R6880:Sphkap UTSW 1 83257257 missense probably damaging 1.00
R6941:Sphkap UTSW 1 83408090 start gained probably benign
R7170:Sphkap UTSW 1 83265985 missense probably damaging 0.99
R7263:Sphkap UTSW 1 83276678 missense probably damaging 1.00
R7422:Sphkap UTSW 1 83263826 missense probably benign 0.02
R7640:Sphkap UTSW 1 83278928 missense possibly damaging 0.94
R7722:Sphkap UTSW 1 83278921 missense probably benign 0.00
R7810:Sphkap UTSW 1 83276300 missense probably damaging 1.00
R7974:Sphkap UTSW 1 83278962 missense probably damaging 1.00
R7990:Sphkap UTSW 1 83267345 missense probably damaging 0.99
R8096:Sphkap UTSW 1 83277558 missense probably damaging 0.98
R8110:Sphkap UTSW 1 83278771 missense possibly damaging 0.82
R8125:Sphkap UTSW 1 83263582 missense probably damaging 1.00
R8153:Sphkap UTSW 1 83278009 missense possibly damaging 0.93
R8245:Sphkap UTSW 1 83278771 missense probably benign 0.14
R8394:Sphkap UTSW 1 83276076 missense probably benign 0.08
R8443:Sphkap UTSW 1 83278232 missense probably benign 0.00
R8508:Sphkap UTSW 1 83276500 missense probably damaging 1.00
Z1088:Sphkap UTSW 1 83276608 missense probably damaging 1.00
Z1088:Sphkap UTSW 1 83278604 missense probably damaging 1.00
Z1176:Sphkap UTSW 1 83276033 nonsense probably null
Z1176:Sphkap UTSW 1 83280442 missense possibly damaging 0.61
Z1177:Sphkap UTSW 1 83276431 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTGTCAAGGCAGATTGCTG -3'
(R):5'- TGATTCAACTGCTAAGTCATTCCC -3'

Sequencing Primer
(F):5'- GCAATTTCAGTTGCCATGGAGAC -3'
(R):5'- TGCTAAGTCATTCCCCAAGG -3'
Posted On2019-12-20