Incidental Mutation 'R7887:Scly'
ID609093
Institutional Source Beutler Lab
Gene Symbol Scly
Ensembl Gene ENSMUSG00000026307
Gene Nameselenocysteine lyase
SynonymsSCL, Scly2, A930015N15Rik, Selenocysteine reductase, Scly1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7887 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location91298338-91321075 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 91300641 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027532] [ENSMUST00000137074] [ENSMUST00000142488] [ENSMUST00000145843] [ENSMUST00000147523] [ENSMUST00000154045]
Predicted Effect probably null
Transcript: ENSMUST00000027532
SMART Domains Protein: ENSMUSP00000027532
Gene: ENSMUSG00000026307

DomainStartEndE-ValueType
Pfam:Aminotran_5 20 417 1.7e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124832
SMART Domains Protein: ENSMUSP00000116382
Gene: ENSMUSG00000026307

DomainStartEndE-ValueType
Pfam:Aminotran_5 18 215 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137074
SMART Domains Protein: ENSMUSP00000122449
Gene: ENSMUSG00000026307

DomainStartEndE-ValueType
Pfam:Aminotran_5 48 216 7.4e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000142488
SMART Domains Protein: ENSMUSP00000119979
Gene: ENSMUSG00000026307

DomainStartEndE-ValueType
Pfam:Aminotran_5 42 238 2.2e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000145843
SMART Domains Protein: ENSMUSP00000116824
Gene: ENSMUSG00000026307

DomainStartEndE-ValueType
Pfam:Aminotran_5 1 68 1.5e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147523
SMART Domains Protein: ENSMUSP00000114759
Gene: ENSMUSG00000026307

DomainStartEndE-ValueType
Pfam:Aminotran_5 22 249 2.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154045
SMART Domains Protein: ENSMUSP00000137796
Gene: ENSMUSG00000026307

DomainStartEndE-ValueType
PDB:3A9Z|B 1 57 5e-30 PDB
SCOP:d1eg5a_ 20 57 3e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Selenocysteine lyase (SCLY; EC 4.4.1.16) catalyzes the pyridoxal 5-prime phosphate-dependent conversion of L-selenocysteine to L-alanine and elemental selenium (Mihara et al., 2000 [PubMed 10692412]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice fed a selenium-deficient diet exhibit mild learning impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Scly
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Scly APN 1 91319041 missense probably benign 0.00
IGL02690:Scly APN 1 91305325 missense probably benign
R0597:Scly UTSW 1 91309833 missense probably damaging 1.00
R1782:Scly UTSW 1 91308380 missense probably damaging 1.00
R1950:Scly UTSW 1 91305394 missense probably benign 0.08
R1978:Scly UTSW 1 91320169 missense probably damaging 0.98
R2290:Scly UTSW 1 91298450 critical splice donor site probably null
R3861:Scly UTSW 1 91302851 utr 3 prime probably benign
R4508:Scly UTSW 1 91308325 missense possibly damaging 0.95
R4876:Scly UTSW 1 91320128 missense probably damaging 0.98
R7035:Scly UTSW 1 91308403 missense probably damaging 0.98
R7701:Scly UTSW 1 91308308 missense
R8079:Scly UTSW 1 91308367 missense probably damaging 0.99
R8501:Scly UTSW 1 91319076 missense probably damaging 1.00
X0021:Scly UTSW 1 91320106 missense probably damaging 0.98
Z1176:Scly UTSW 1 91305313 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGACCCTCACTGTGGTCC -3'
(R):5'- TGAAAGTCCACCCCATTCCC -3'

Sequencing Primer
(F):5'- CTGTGGTCCCCCAAAAGAGTATTG -3'
(R):5'- ACACGGATTCTCAGTTTAGGTAGCC -3'
Posted On2019-12-20