Mutagenetix > Incidental Mutations

Incidental Mutation 'R7887:Wdr64'

609095

Institutional Source

Beutler Lab

Gene Symbol

Wdr64

Ensembl Gene

ENSMUSG00000026523

Gene Name

WD repeat domain 64

Synonyms

4930511H01Rik, 4930415O10Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_029453.2; MGI:1923070

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R7887 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

175698593-175815734 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 175785545 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 662 (A662V)

Ref Sequence

ENSEMBL: ENSMUSP00000128678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171939]

Predicted Effect

not run
Transcript: ENSMUST00000171939
AA Change: A662V

SMART Domains

Protein: ENSMUSP00000128678
Gene: ENSMUSG00000026523
AA Change: A662V

Domain	Start	End	E-Value	Type
WD40	151	190	5.73e0	SMART
low complexity region	249	261	N/A	INTRINSIC
Blast:WD40	267	306	4e-19	BLAST
WD40	313	351	2.4e-1	SMART
WD40	355	394	8.29e-1	SMART
WD40	397	439	1.7e2	SMART
WD40	447	483	1.19e1	SMART
WD40	487	528	4.55e-3	SMART
WD40	633	674	3.31e0	SMART
WD40	732	796	7.4e0	SMART
Blast:WD40	801	841	5e-17	BLAST
WD40	854	893	4.62e-4	SMART
Blast:XPGN	911	954	1e-18	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (48/49)

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh8	T	A	9: 3,385,343	I580N	probably damaging	Het
Ankrd35	C	T	3: 96,684,900	T834M	probably damaging	Het
Astn2	C	T	4: 65,644,866	V893I	possibly damaging	Het
B4galt1	A	G	4: 40,823,501	Y197H	probably benign	Het
Brdt	T	C	5: 107,359,933	S676P	possibly damaging	Het
Chrdl2	T	C	7: 100,029,250	V343A	possibly damaging	Het
Clcn3	A	T	8: 60,941,399	M59K	probably benign	Het
Cpne4	A	T	9: 105,032,791	N529I	probably damaging	Het
Crcp	G	T	5: 130,037,870	K32N	possibly damaging	Het
Ddx54	C	T	5: 120,627,203	R846C	probably damaging	Het
Dennd6a	T	C	14: 26,599,657	S118P	possibly damaging	Het
Egr3	A	G	14: 70,079,202	Y116C	probably damaging	Het
Fbxw25	A	G	9: 109,649,594		probably null	Het
Focad	T	G	4: 88,182,616	I313M	probably damaging	Het
Gm10272	C	T	10: 77,706,945	P107L	probably benign	Het
Gpr26	A	C	7: 131,966,973	I16L	probably benign	Het
Gpr39	C	A	1: 125,677,542	T69K	probably damaging	Het
Hacl1	C	T	14: 31,634,227	G97S	probably damaging	Het
Idh3b	A	C	2: 130,281,758	D136E	probably damaging	Het
Irf6	G	A	1: 193,167,732	V321M	probably damaging	Het
Klrg2	T	A	6: 38,636,571	T166S	probably damaging	Het
Lnx2	T	C	5: 147,019,043	I648V	probably damaging	Het
Mecr	A	G	4: 131,860,866		probably null	Het
Mnat1	T	A	12: 73,188,191	S205T	probably benign	Het
Mpnd	G	A	17: 56,011,097	G204D	probably benign	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Nid1	G	T	13: 13,499,733	R899L	possibly damaging	Het
Nisch	C	T	14: 31,176,695	W664*	probably null	Het
Nudt6	C	T	3: 37,412,380	V157I	possibly damaging	Het
Olfr1156	T	C	2: 87,949,880	M118V	probably damaging	Het
Olfr573-ps1	A	C	7: 102,942,151	L142R	possibly damaging	Het
Olfr949-ps1	A	T	9: 39,364,879	M107L	unknown	Het
Onecut2	T	A	18: 64,340,975	M180K	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pclo	GTCTAT	GTCTATTCTAT	5: 14,714,190		probably null	Het
Phf11d	A	G	14: 59,359,580	Y57H	probably damaging	Het
Prkaca	T	C	8: 83,986,895	V99A	probably benign	Het
Rnf144b	T	A	13: 47,239,811	C209S	probably damaging	Het
Scly	G	A	1: 91,300,641		probably null	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sphkap	T	C	1: 83,277,412	Y872C	probably benign	Het
Ssh1	C	T	5: 113,961,349		probably null	Het
Strap	T	G	6: 137,739,809	L129V	possibly damaging	Het
Sympk	T	C	7: 19,034,439	I111T	possibly damaging	Het
Tprn	C	A	2: 25,264,012	A442E	probably damaging	Het
Tsen34	T	C	7: 3,694,708	L36P	probably damaging	Het
Ubr4	T	C	4: 139,407,810	F818L	probably damaging	Het
Uggt1	T	C	1: 36,208,034	Y294C	probably damaging	Het
Usp20	A	G	2: 31,020,894	K862E	probably benign	Het
Vmn1r201	A	T	13: 22,474,786	I57F	probably damaging	Het

Other mutations in Wdr64

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00563:Wdr64	APN	1	175698800	missense	probably benign	0.00
IGL00902:Wdr64	APN	1	175728825	missense	probably damaging	1.00
IGL01347:Wdr64	APN	1	175720333	missense	probably benign	0.12
IGL01353:Wdr64	APN	1	175731585	missense	probably damaging	0.96
IGL01583:Wdr64	APN	1	175767156	critical splice donor site	probably null
IGL01643:Wdr64	APN	1	175772311	missense	probably damaging	1.00
IGL01673:Wdr64	APN	1	175800356	missense	possibly damaging	0.68
IGL01992:Wdr64	APN	1	175706071	missense	probably damaging	1.00
IGL02613:Wdr64	APN	1	175767047	nonsense	probably null
IGL02834:Wdr64	APN	1	175805849	splice site	probably benign
IGL03214:Wdr64	APN	1	175743635	splice site	probably benign
IGL03305:Wdr64	APN	1	175755586	missense	possibly damaging	0.94
IGL03308:Wdr64	APN	1	175766996	unclassified	probably benign
PIT4418001:Wdr64	UTSW	1	175743594	nonsense	probably null
R0036:Wdr64	UTSW	1	175728930	nonsense	probably null
R0041:Wdr64	UTSW	1	175726471	nonsense	probably null
R0041:Wdr64	UTSW	1	175726471	nonsense	probably null
R0079:Wdr64	UTSW	1	175795102	missense	probably benign	0.02
R0380:Wdr64	UTSW	1	175769642	splice site	probably benign
R0486:Wdr64	UTSW	1	175795203	splice site	probably benign
R0520:Wdr64	UTSW	1	175726392	missense	probably damaging	1.00
R0598:Wdr64	UTSW	1	175805899	missense	probably damaging	1.00
R0711:Wdr64	UTSW	1	175772185	missense	probably benign	0.39
R0746:Wdr64	UTSW	1	175792973	missense	possibly damaging	0.92
R0927:Wdr64	UTSW	1	175793081	missense	probably damaging	0.97
R0947:Wdr64	UTSW	1	175775749	missense	probably benign
R1014:Wdr64	UTSW	1	175755626	missense	probably damaging	1.00
R1332:Wdr64	UTSW	1	175795140	missense	possibly damaging	0.82
R1416:Wdr64	UTSW	1	175806002	missense	probably benign	0.01
R1421:Wdr64	UTSW	1	175767150	missense	possibly damaging	0.85
R1467:Wdr64	UTSW	1	175775722	missense	probably benign	0.00
R1467:Wdr64	UTSW	1	175775722	missense	probably benign	0.00
R1796:Wdr64	UTSW	1	175717331	missense	probably damaging	1.00
R1797:Wdr64	UTSW	1	175812019	missense	probably damaging	1.00
R2145:Wdr64	UTSW	1	175767095	missense	probably benign	0.01
R2321:Wdr64	UTSW	1	175795087	missense	possibly damaging	0.57
R2449:Wdr64	UTSW	1	175698913	missense	probably benign
R4049:Wdr64	UTSW	1	175805856	missense	probably benign	0.21
R4155:Wdr64	UTSW	1	175769606	missense	probably benign	0.03
R4624:Wdr64	UTSW	1	175772263	missense	probably benign
R4661:Wdr64	UTSW	1	175726494	missense	probably damaging	1.00
R4711:Wdr64	UTSW	1	175799229	missense	probably damaging	1.00
R4891:Wdr64	UTSW	1	175698779	unclassified	probably benign
R4925:Wdr64	UTSW	1	175724702	splice site	probably null
R4943:Wdr64	UTSW	1	175720316	missense	probably benign	0.01
R5000:Wdr64	UTSW	1	175726375	splice site	probably null
R5001:Wdr64	UTSW	1	175792959	critical splice acceptor site	probably null
R5143:Wdr64	UTSW	1	175726413	missense	probably damaging	1.00
R5395:Wdr64	UTSW	1	175755598	missense	probably damaging	1.00
R5813:Wdr64	UTSW	1	175812057	missense	possibly damaging	0.89
R6014:Wdr64	UTSW	1	175805990	missense	possibly damaging	0.56
R6417:Wdr64	UTSW	1	175726390	missense	probably damaging	1.00
R6456:Wdr64	UTSW	1	175785609	critical splice donor site	probably null
R6555:Wdr64	UTSW	1	175720290	missense	probably damaging	1.00
R6576:Wdr64	UTSW	1	175805928	missense	possibly damaging	0.82
R6797:Wdr64	UTSW	1	175810610	critical splice donor site	probably null
R6891:Wdr64	UTSW	1	175706068	missense	probably damaging	1.00
R6959:Wdr64	UTSW	1	175705989	missense	probably damaging	1.00
R7205:Wdr64	UTSW	1	175789933	missense	probably benign	0.34
R7252:Wdr64	UTSW	1	175775674	missense	probably benign	0.00
R7552:Wdr64	UTSW	1	175785581	missense	possibly damaging	0.71
R7732:Wdr64	UTSW	1	175789929	missense	probably benign
R7777:Wdr64	UTSW	1	175789998	missense	possibly damaging	0.71
R7780:Wdr64	UTSW	1	175728976	missense	probably damaging	1.00
R7810:Wdr64	UTSW	1	175731526	missense	probably benign	0.01
R7833:Wdr64	UTSW	1	175763945	missense	probably damaging	1.00
R7843:Wdr64	UTSW	1	175812102	missense	probably benign	0.00
R7991:Wdr64	UTSW	1	175726485	missense	probably benign	0.36
R8124:Wdr64	UTSW	1	175799278	splice site	probably null
R8129:Wdr64	UTSW	1	175775588	missense	probably damaging	0.96
Z1088:Wdr64	UTSW	1	175705985	missense	possibly damaging	0.71

Predicted Primers

Posted On

2019-12-20