Incidental Mutation 'R7887:Tprn'
ID609097
Institutional Source Beutler Lab
Gene Symbol Tprn
Ensembl Gene ENSMUSG00000048707
Gene Nametaperin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7887 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25262618-25269885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25264012 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 442 (A442E)
Ref Sequence ENSEMBL: ENSMUSP00000109975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114336]
Predicted Effect probably damaging
Transcript: ENSMUST00000114336
AA Change: A442E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109975
Gene: ENSMUSG00000048707
AA Change: A442E

DomainStartEndE-ValueType
Pfam:Phostensin_N 8 89 8.3e-38 PFAM
low complexity region 105 117 N/A INTRINSIC
internal_repeat_1 149 273 1.71e-5 PROSPERO
low complexity region 290 322 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
Pfam:Phostensin 506 645 1.8e-65 PFAM
low complexity region 647 665 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sensory epithelial protein. It was defined by linkage analysis in three Pakistani families to lie between D9S1818 (centromeric) and D9SH6 (telomeric). Mutations at this locus have been associated with autosomal recessive deafness. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss and degeneration of hair cell stereocilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Tprn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03072:Tprn APN 2 25264518 missense probably damaging 1.00
IGL03139:Tprn APN 2 25264054 missense probably benign 0.31
R0568:Tprn UTSW 2 25264321 missense probably damaging 1.00
R0615:Tprn UTSW 2 25264198 missense probably damaging 0.97
R0706:Tprn UTSW 2 25264491 missense probably damaging 1.00
R1675:Tprn UTSW 2 25264409 missense probably benign 0.01
R2508:Tprn UTSW 2 25268928 missense possibly damaging 0.95
R4257:Tprn UTSW 2 25264482 missense probably damaging 1.00
R4493:Tprn UTSW 2 25268892 missense probably damaging 1.00
R4494:Tprn UTSW 2 25268892 missense probably damaging 1.00
R4898:Tprn UTSW 2 25268833 missense probably damaging 0.99
R5536:Tprn UTSW 2 25263357 missense probably benign 0.07
R5537:Tprn UTSW 2 25263357 missense probably benign 0.07
R6753:Tprn UTSW 2 25264038 missense probably benign
R7554:Tprn UTSW 2 25263799 missense probably damaging 1.00
X0003:Tprn UTSW 2 25268911 unclassified probably benign
X0010:Tprn UTSW 2 25268911 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGATCCCCAAGCGCAAAG -3'
(R):5'- TTGAAAGGCCTCCTCCTCTG -3'

Sequencing Primer
(F):5'- AAAGCCCCTGGGAACTATCCTTTG -3'
(R):5'- AAAGGCCTCCTCCTCTGAGTCTAC -3'
Posted On2019-12-20