Incidental Mutation 'R7887:Nudt6'
ID609101
Institutional Source Beutler Lab
Gene Symbol Nudt6
Ensembl Gene ENSMUSG00000050174
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R7887 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location37404910-37420211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37412380 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 157 (V157I)
Ref Sequence ENSEMBL: ENSMUSP00000056219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052645] [ENSMUST00000099130] [ENSMUST00000108117] [ENSMUST00000108118] [ENSMUST00000141438] [ENSMUST00000146324] [ENSMUST00000149449] [ENSMUST00000200585]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052645
AA Change: V157I

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056219
Gene: ENSMUSG00000050174
AA Change: V157I

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 1e-42 PDB
Pfam:NUDIX 139 270 2.7e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099130
AA Change: V157I

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096733
Gene: ENSMUSG00000050174
AA Change: V157I

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 1e-42 PDB
Pfam:NUDIX 139 269 7.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108117
SMART Domains Protein: ENSMUSP00000103752
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
PDB:3FXT|H 42 76 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108118
AA Change: V89I

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103753
Gene: ENSMUSG00000050174
AA Change: V89I

DomainStartEndE-ValueType
Pfam:NUDIX 73 202 1.7e-22 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000118428
Gene: ENSMUSG00000050174
AA Change: V123I

DomainStartEndE-ValueType
PDB:3FXT|H 17 98 4e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000141438
SMART Domains Protein: ENSMUSP00000142588
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
PDB:3H95|A 2 97 5e-55 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000146324
SMART Domains Protein: ENSMUSP00000142653
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
Pfam:NUDIX 1 104 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149449
SMART Domains Protein: ENSMUSP00000116572
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 3e-44 PDB
PDB:3H95|A 132 191 6e-22 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000198158
Predicted Effect probably benign
Transcript: ENSMUST00000200585
SMART Domains Protein: ENSMUSP00000143094
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 25 151 2.08e-65 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene overlaps and lies on the opposite strand from FGF2 gene, and is thought to be the FGF2 antisense gene. The two genes are independently transcribed, and their expression shows an inverse relationship, suggesting that this antisense transcript may regulate FGF2 expression. This gene has also been shown to have hormone-regulatory and antiproliferative actions in the pituitary that are independent of FGF2 expression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Nudt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Nudt6 APN 3 37405171 missense probably benign 0.03
IGL02965:Nudt6 APN 3 37419506 missense probably damaging 0.99
IGL02975:Nudt6 APN 3 37419518 missense probably damaging 1.00
R0927:Nudt6 UTSW 3 37405353 missense probably benign 0.01
R1884:Nudt6 UTSW 3 37412400 missense probably benign 0.02
R1939:Nudt6 UTSW 3 37405230 missense probably damaging 1.00
R2122:Nudt6 UTSW 3 37412405 missense probably benign 0.01
R4416:Nudt6 UTSW 3 37405229 unclassified probably null
R4801:Nudt6 UTSW 3 37405354 missense probably benign 0.01
R4802:Nudt6 UTSW 3 37405354 missense probably benign 0.01
R5826:Nudt6 UTSW 3 37419468 missense probably benign 0.05
R6362:Nudt6 UTSW 3 37419489 missense possibly damaging 0.66
R7970:Nudt6 UTSW 3 37412380 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GACAGGTTTAGGTCTGTGTCACAG -3'
(R):5'- TGAGTAATGACCTCCTTGCTG -3'

Sequencing Primer
(F):5'- CTGTGTCACAGCTTTATTTAGATAGG -3'
(R):5'- CCTTGCTGGAGAGGTGTTTTATAGTC -3'
Posted On2019-12-20