Incidental Mutation 'R7887:Ankrd35'
ID609102
Institutional Source Beutler Lab
Gene Symbol Ankrd35
Ensembl Gene ENSMUSG00000038354
Gene Nameankyrin repeat domain 35
Synonyms4732436F15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7887 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location96670131-96691032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96684900 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 834 (T834M)
Ref Sequence ENSEMBL: ENSMUSP00000047244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048427] [ENSMUST00000122960]
Predicted Effect probably damaging
Transcript: ENSMUST00000048427
AA Change: T834M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047244
Gene: ENSMUSG00000038354
AA Change: T834M

DomainStartEndE-ValueType
ANK 53 82 4.03e-5 SMART
ANK 86 115 6.46e-4 SMART
ANK 119 148 4.36e-1 SMART
ANK 152 181 1.4e-4 SMART
ANK 185 214 2.25e-3 SMART
ANK 218 247 6.24e2 SMART
coiled coil region 294 339 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
coiled coil region 606 653 N/A INTRINSIC
coiled coil region 729 799 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 847 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122960
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Ankrd35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Ankrd35 APN 3 96683034 splice site probably null
IGL00896:Ankrd35 APN 3 96684276 missense probably damaging 1.00
IGL01565:Ankrd35 APN 3 96684785 missense probably damaging 0.99
IGL01837:Ankrd35 APN 3 96680666 missense probably damaging 1.00
IGL02605:Ankrd35 APN 3 96681072 splice site probably null
IGL02819:Ankrd35 APN 3 96690208 missense possibly damaging 0.80
IGL02994:Ankrd35 APN 3 96682991 splice site probably benign
IGL03083:Ankrd35 APN 3 96684801 missense probably damaging 1.00
IGL03105:Ankrd35 APN 3 96684057 missense probably benign
FR4304:Ankrd35 UTSW 3 96683847 utr 3 prime probably benign
FR4342:Ankrd35 UTSW 3 96683515 frame shift probably null
FR4737:Ankrd35 UTSW 3 96683849 utr 3 prime probably benign
R0003:Ankrd35 UTSW 3 96684015 missense probably damaging 1.00
R0047:Ankrd35 UTSW 3 96684063 missense probably benign 0.00
R0551:Ankrd35 UTSW 3 96683960 missense probably benign 0.08
R1420:Ankrd35 UTSW 3 96684738 missense probably benign 0.13
R1455:Ankrd35 UTSW 3 96678155 missense probably damaging 1.00
R2201:Ankrd35 UTSW 3 96679248 missense possibly damaging 0.93
R3522:Ankrd35 UTSW 3 96685062 missense probably damaging 1.00
R3605:Ankrd35 UTSW 3 96682181 nonsense probably null
R4166:Ankrd35 UTSW 3 96679155 splice site probably null
R4651:Ankrd35 UTSW 3 96684027 missense probably benign 0.00
R4668:Ankrd35 UTSW 3 96679208 missense probably damaging 1.00
R4916:Ankrd35 UTSW 3 96684122 missense probably benign
R4921:Ankrd35 UTSW 3 96684824 missense possibly damaging 0.61
R4953:Ankrd35 UTSW 3 96683673 missense possibly damaging 0.56
R5180:Ankrd35 UTSW 3 96680473 missense probably damaging 1.00
R5583:Ankrd35 UTSW 3 96684903 missense probably damaging 1.00
R5604:Ankrd35 UTSW 3 96684899 missense probably benign 0.02
R5613:Ankrd35 UTSW 3 96683018 missense possibly damaging 0.76
R6165:Ankrd35 UTSW 3 96683307 missense possibly damaging 0.93
R6413:Ankrd35 UTSW 3 96684813 missense probably damaging 0.96
R6711:Ankrd35 UTSW 3 96683468 nonsense probably null
R6834:Ankrd35 UTSW 3 96683283 missense possibly damaging 0.68
R6841:Ankrd35 UTSW 3 96670426 missense probably damaging 1.00
R7028:Ankrd35 UTSW 3 96683334 missense possibly damaging 0.92
R7396:Ankrd35 UTSW 3 96683497 missense probably damaging 1.00
R7425:Ankrd35 UTSW 3 96684788 missense not run
R7815:Ankrd35 UTSW 3 96684801 missense probably damaging 1.00
R8103:Ankrd35 UTSW 3 96679681 missense possibly damaging 0.93
R8318:Ankrd35 UTSW 3 96684722 missense probably damaging 1.00
Z1177:Ankrd35 UTSW 3 96683770 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTCAAGGTTACAGCATCCC -3'
(R):5'- TTTCTCGAACTGCTCCGAGC -3'

Sequencing Primer
(F):5'- GTTACAGCATCCCCGCAAGTG -3'
(R):5'- GCATCTCGCCAGCCTGG -3'
Posted On2019-12-20