Mutagenetix > Incidental Mutation

Incidental Mutation 'R7887:Astn2'

609104

Institutional Source

Beutler Lab

Gene Symbol

Astn2

Ensembl Gene

ENSMUSG00000028373

Gene Name

astrotactin 2

Synonyms

1d8, Astnl

MMRRC Submission

Accession Numbers

Genbank: NM _019514.3, NM _207109.2; Ensembl: ENSMUST 00000068214, ENSMUST 00000084496

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R7887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65380803-66404611 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 65644866 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 893 (V893I)

Ref Sequence

ENSEMBL: ENSMUSP00000065786 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]

AlphaFold

Q80Z10

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068214
AA Change: V893I

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373
AA Change: V893I

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	87	127	N/A	INTRINSIC
transmembrane domain	219	241	N/A	INTRINSIC
low complexity region	303	312	N/A	INTRINSIC
low complexity region	342	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	432	437	N/A	INTRINSIC
transmembrane domain	443	465	N/A	INTRINSIC
EGF_like	526	563	2.92e1	SMART
Blast:EGF_like	667	708	2e-18	BLAST
EGF_like	715	764	4.03e1	SMART
MACPF	864	1048	2.88e-55	SMART
FN3	1079	1191	2.41e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084496
AA Change: V841I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373
AA Change: V841I

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	87	127	N/A	INTRINSIC
transmembrane domain	219	241	N/A	INTRINSIC
low complexity region	303	312	N/A	INTRINSIC
low complexity region	341	352	N/A	INTRINSIC
low complexity region	380	385	N/A	INTRINSIC
transmembrane domain	391	413	N/A	INTRINSIC
EGF_like	474	511	2.92e1	SMART
Blast:EGF_like	615	656	2e-18	BLAST
EGF_like	663	712	4.03e1	SMART
MACPF	812	996	2.88e-55	SMART
FN3	1027	1139	2.41e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh8	T	A	9: 3,385,343	I580N	probably damaging	Het
Ankrd35	C	T	3: 96,684,900	T834M	probably damaging	Het
B4galt1	A	G	4: 40,823,501	Y197H	probably benign	Het
Brdt	T	C	5: 107,359,933	S676P	possibly damaging	Het
Chrdl2	T	C	7: 100,029,250	V343A	possibly damaging	Het
Clcn3	A	T	8: 60,941,399	M59K	probably benign	Het
Cpne4	A	T	9: 105,032,791	N529I	probably damaging	Het
Crcp	G	T	5: 130,037,870	K32N	possibly damaging	Het
Ddx54	C	T	5: 120,627,203	R846C	probably damaging	Het
Dennd6a	T	C	14: 26,599,657	S118P	possibly damaging	Het
Egr3	A	G	14: 70,079,202	Y116C	probably damaging	Het
Fbxw25	A	G	9: 109,649,594		probably null	Het
Focad	T	G	4: 88,182,616	I313M	probably damaging	Het
Gm10272	C	T	10: 77,706,945	P107L	probably benign	Het
Gpr26	A	C	7: 131,966,973	I16L	probably benign	Het
Gpr39	C	A	1: 125,677,542	T69K	probably damaging	Het
Hacl1	C	T	14: 31,634,227	G97S	probably damaging	Het
Idh3b	A	C	2: 130,281,758	D136E	probably damaging	Het
Irf6	G	A	1: 193,167,732	V321M	probably damaging	Het
Klrg2	T	A	6: 38,636,571	T166S	probably damaging	Het
Lnx2	T	C	5: 147,019,043	I648V	probably damaging	Het
Mecr	A	G	4: 131,860,866		probably null	Het
Mnat1	T	A	12: 73,188,191	S205T	probably benign	Het
Mpnd	G	A	17: 56,011,097	G204D	probably benign	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Nid1	G	T	13: 13,499,733	R899L	possibly damaging	Het
Nisch	C	T	14: 31,176,695	W664*	probably null	Het
Nudt6	C	T	3: 37,412,380	V157I	possibly damaging	Het
Olfr1156	T	C	2: 87,949,880	M118V	probably damaging	Het
Olfr573-ps1	A	C	7: 102,942,151	L142R	possibly damaging	Het
Olfr949-ps1	A	T	9: 39,364,879	M107L	unknown	Het
Onecut2	T	A	18: 64,340,975	M180K	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pclo	GTCTAT	GTCTATTCTAT	5: 14,714,190		probably null	Het
Phf11d	A	G	14: 59,359,580	Y57H	probably damaging	Het
Prkaca	T	C	8: 83,986,895	V99A	probably benign	Het
Rnf144b	T	A	13: 47,239,811	C209S	probably damaging	Het
Scly	G	A	1: 91,300,641		probably null	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sphkap	T	C	1: 83,277,412	Y872C	probably benign	Het
Ssh1	C	T	5: 113,961,349		probably null	Het
Strap	T	G	6: 137,739,809	L129V	possibly damaging	Het
Sympk	T	C	7: 19,034,439	I111T	possibly damaging	Het
Tprn	C	A	2: 25,264,012	A442E	probably damaging	Het
Tsen34	T	C	7: 3,694,708	L36P	probably damaging	Het
Ubr4	T	C	4: 139,407,810	F818L	probably damaging	Het
Uggt1	T	C	1: 36,208,034	Y294C	probably damaging	Het
Usp20	A	G	2: 31,020,894	K862E	probably benign	Het
Vmn1r201	A	T	13: 22,474,786	I57F	probably damaging	Het
Wdr64	C	T	1: 175,785,545	A662V	not run	Het

Other mutations in Astn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Astn2	APN	4	66185187	missense	unknown
IGL01657:Astn2	APN	4	65651949	missense	probably damaging	0.99
IGL01747:Astn2	APN	4	65794618	missense	probably benign	0.17
IGL02008:Astn2	APN	4	66059153	missense	probably damaging	1.00
IGL02215:Astn2	APN	4	66266234	missense	unknown
IGL02484:Astn2	APN	4	65992279	splice site	probably benign
IGL02494:Astn2	APN	4	65992348	missense	probably benign	0.23
IGL02792:Astn2	APN	4	65644821	missense	probably benign	0.32
IGL03248:Astn2	APN	4	65746293	splice site	probably benign
IGL03409:Astn2	APN	4	65435186	missense	possibly damaging	0.46
B6584:Astn2	UTSW	4	65992387	missense	probably damaging	0.99
R0015:Astn2	UTSW	4	66266382	critical splice acceptor site	probably null
R0015:Astn2	UTSW	4	66266382	critical splice acceptor site	probably null
R0092:Astn2	UTSW	4	66403982	missense	unknown
R0245:Astn2	UTSW	4	65794558	missense	probably damaging	0.99
R0528:Astn2	UTSW	4	65644882	splice site	probably benign
R0586:Astn2	UTSW	4	66185142	missense	unknown
R0652:Astn2	UTSW	4	65794558	missense	probably damaging	0.99
R0880:Astn2	UTSW	4	65648330	missense	probably damaging	0.99
R0931:Astn2	UTSW	4	65648293	missense	probably damaging	0.99
R1353:Astn2	UTSW	4	66266335	missense	unknown
R1700:Astn2	UTSW	4	65746354	nonsense	probably null
R1934:Astn2	UTSW	4	65435189	missense	probably damaging	0.99
R2017:Astn2	UTSW	4	65540941	missense	probably damaging	0.99
R2101:Astn2	UTSW	4	65581686	nonsense	probably null
R2158:Astn2	UTSW	4	66404254	missense	unknown
R2907:Astn2	UTSW	4	65644856	missense	possibly damaging	0.92
R2923:Astn2	UTSW	4	65913773	missense	probably damaging	1.00
R2938:Astn2	UTSW	4	65992313	missense	possibly damaging	0.92
R3033:Astn2	UTSW	4	65644706	missense	probably damaging	1.00
R3933:Astn2	UTSW	4	66403955	missense	unknown
R4151:Astn2	UTSW	4	65729320	critical splice donor site	probably null
R4230:Astn2	UTSW	4	65911682	missense	probably damaging	0.99
R4497:Astn2	UTSW	4	66119063	intron	probably benign
R4717:Astn2	UTSW	4	65644754	missense	possibly damaging	0.86
R4844:Astn2	UTSW	4	65644730	missense	possibly damaging	0.90
R4928:Astn2	UTSW	4	65729407	missense	probably damaging	0.98
R5374:Astn2	UTSW	4	65397005	missense	probably damaging	0.96
R5442:Astn2	UTSW	4	65581786	missense	possibly damaging	0.86
R5694:Astn2	UTSW	4	65950138	missense	probably damaging	1.00
R5756:Astn2	UTSW	4	66119188	intron	probably benign
R5763:Astn2	UTSW	4	65729331	missense	probably benign	0.14
R6089:Astn2	UTSW	4	65794573	missense	probably damaging	0.96
R6990:Astn2	UTSW	4	65992303	missense	possibly damaging	0.82
R7304:Astn2	UTSW	4	66185375	missense	unknown
R7325:Astn2	UTSW	4	65542669	missense	probably benign	0.33
R7356:Astn2	UTSW	4	66185266	missense	unknown
R7414:Astn2	UTSW	4	65540956	missense	possibly damaging	0.85
R7755:Astn2	UTSW	4	65794558	missense	probably damaging	0.99
R8027:Astn2	UTSW	4	65540971	missense	possibly damaging	0.86
R8046:Astn2	UTSW	4	66266350	nonsense	probably null
R8188:Astn2	UTSW	4	66059181	missense	unknown
R8271:Astn2	UTSW	4	65992426	missense	unknown
R8274:Astn2	UTSW	4	65651861	critical splice donor site	probably null
R8505:Astn2	UTSW	4	65381588	missense	unknown
R8815:Astn2	UTSW	4	65912597	missense	possibly damaging	0.96
R8989:Astn2	UTSW	4	65581653	missense	possibly damaging	0.53
R9013:Astn2	UTSW	4	65992347	missense	probably benign	0.23
R9127:Astn2	UTSW	4	66403927	missense	unknown
R9255:Astn2	UTSW	4	65644848	nonsense	probably null
R9297:Astn2	UTSW	4	65542723	missense	possibly damaging	0.85
R9320:Astn2	UTSW	4	66404149	missense	unknown
R9349:Astn2	UTSW	4	66266255	missense	unknown
R9399:Astn2	UTSW	4	65746351	missense	possibly damaging	0.71
R9572:Astn2	UTSW	4	65381635	missense	unknown
R9573:Astn2	UTSW	4	65648354	missense	probably benign	0.08
R9674:Astn2	UTSW	4	65542726	missense	probably damaging	0.98
R9722:Astn2	UTSW	4	65913741	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- ACCCAGCTCACAGATAGGAG -3'
(R):5'- GCAGTGAAAGTCAGCCTTTG -3'

Sequencing Primer
(F):5'- CTCACAGATAGGAGAAATGGGCTCTG -3'
(R):5'- GCTATAAGCAGGTAAGCCTAGAG -3'

Posted On

2019-12-20