Mutagenetix > Incidental Mutations

Incidental Mutation 'R7887:Focad'

609105

Institutional Source

Beutler Lab

Gene Symbol

Focad

Ensembl Gene

ENSMUSG00000038368

Gene Name

focadhesin

Synonyms

BC057079

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.462) question?

Stock #

R7887 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88094629-88411011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 88182616 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 313 (I313M)

Ref Sequence

ENSEMBL: ENSMUSP00000124298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]

Predicted Effect

unknown
Transcript: ENSMUST00000097992
AA Change: I313M

SMART Domains

Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: I313M

Domain	Start	End	E-Value	Type
low complexity region	150	161	N/A	INTRINSIC
low complexity region	194	203	N/A	INTRINSIC
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	490	714	1.5e-71	PFAM
low complexity region	957	969	N/A	INTRINSIC
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1200	1209	N/A	INTRINSIC
Pfam:DUF3028	1210	1798	1.5e-291	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159342
AA Change: I313M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: I313M

Domain	Start	End	E-Value	Type
Pfam:DUF3730	20	250	5.8e-27	PFAM
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	403	633	2.8e-61	PFAM
low complexity region	871	883	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1114	1123	N/A	INTRINSIC
Pfam:DUF3028	1124	1712	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh8	T	A	9: 3,385,343	I580N	probably damaging	Het
Ankrd35	C	T	3: 96,684,900	T834M	probably damaging	Het
Astn2	C	T	4: 65,644,866	V893I	possibly damaging	Het
B4galt1	A	G	4: 40,823,501	Y197H	probably benign	Het
Brdt	T	C	5: 107,359,933	S676P	possibly damaging	Het
Chrdl2	T	C	7: 100,029,250	V343A	possibly damaging	Het
Clcn3	A	T	8: 60,941,399	M59K	probably benign	Het
Cpne4	A	T	9: 105,032,791	N529I	probably damaging	Het
Crcp	G	T	5: 130,037,870	K32N	possibly damaging	Het
Ddx54	C	T	5: 120,627,203	R846C	probably damaging	Het
Dennd6a	T	C	14: 26,599,657	S118P	possibly damaging	Het
Egr3	A	G	14: 70,079,202	Y116C	probably damaging	Het
Fbxw25	A	G	9: 109,649,594		probably null	Het
Gm10272	C	T	10: 77,706,945	P107L	probably benign	Het
Gpr26	A	C	7: 131,966,973	I16L	probably benign	Het
Gpr39	C	A	1: 125,677,542	T69K	probably damaging	Het
Hacl1	C	T	14: 31,634,227	G97S	probably damaging	Het
Idh3b	A	C	2: 130,281,758	D136E	probably damaging	Het
Irf6	G	A	1: 193,167,732	V321M	probably damaging	Het
Klrg2	T	A	6: 38,636,571	T166S	probably damaging	Het
Lnx2	T	C	5: 147,019,043	I648V	probably damaging	Het
Mnat1	T	A	12: 73,188,191	S205T	probably benign	Het
Mpnd	G	A	17: 56,011,097	G204D	probably benign	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Nid1	G	T	13: 13,499,733	R899L	possibly damaging	Het
Nisch	C	T	14: 31,176,695	W664*	probably null	Het
Nudt6	C	T	3: 37,412,380	V157I	possibly damaging	Het
Olfr1156	T	C	2: 87,949,880	M118V	probably damaging	Het
Olfr573-ps1	A	C	7: 102,942,151	L142R	possibly damaging	Het
Olfr949-ps1	A	T	9: 39,364,879	M107L	unknown	Het
Onecut2	T	A	18: 64,340,975	M180K	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pclo	GTCTAT	GTCTATTCTAT	5: 14,714,190		probably null	Het
Phf11d	A	G	14: 59,359,580	Y57H	probably damaging	Het
Prkaca	T	C	8: 83,986,895	V99A	probably benign	Het
Rnf144b	T	A	13: 47,239,811	C209S	probably damaging	Het
Scly	G	A	1: 91,300,641		probably null	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sphkap	T	C	1: 83,277,412	Y872C	probably benign	Het
Ssh1	C	T	5: 113,961,349		probably null	Het
Strap	T	G	6: 137,739,809	L129V	possibly damaging	Het
Sympk	T	C	7: 19,034,439	I111T	possibly damaging	Het
Tprn	C	A	2: 25,264,012	A442E	probably damaging	Het
Tsen34	T	C	7: 3,694,708	L36P	probably damaging	Het
Ubr4	T	C	4: 139,407,810	F818L	probably damaging	Het
Uggt1	T	C	1: 36,208,034	Y294C	probably damaging	Het
Usp20	A	G	2: 31,020,894	K862E	probably benign	Het
Vmn1r201	A	T	13: 22,474,786	I57F	probably damaging	Het
Wdr64	C	T	1: 175,785,545	A662V	not run	Het

Other mutations in Focad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Focad	APN	4	88357474	missense	unknown
IGL00562:Focad	APN	4	88348809	missense	unknown
IGL00563:Focad	APN	4	88348809	missense	unknown
IGL00900:Focad	APN	4	88129023	missense	probably damaging	0.99
IGL00984:Focad	APN	4	88344785	missense	unknown
IGL01016:Focad	APN	4	88392015	missense	possibly damaging	0.51
IGL01069:Focad	APN	4	88326146	missense	unknown
IGL01305:Focad	APN	4	88393547	missense	probably benign	0.32
IGL01409:Focad	APN	4	88342305	missense	unknown
IGL01447:Focad	APN	4	88326228	missense	unknown
IGL01521:Focad	APN	4	88410690	makesense	probably null
IGL01672:Focad	APN	4	88360590	critical splice donor site	probably null
IGL01739:Focad	APN	4	88370806	missense	unknown
IGL02082:Focad	APN	4	88230578	nonsense	probably null
IGL02139:Focad	APN	4	88129054	critical splice donor site	probably null
IGL02381:Focad	APN	4	88274090	splice site	probably benign
IGL02898:Focad	APN	4	88391997	missense	probably benign	0.02
Microscope	UTSW	4	88342204	missense	unknown
Objective	UTSW	4	88401068	nonsense	probably null
ANU22:Focad	UTSW	4	88393547	missense	probably benign	0.32
R0025:Focad	UTSW	4	88408959	missense	probably benign	0.02
R0554:Focad	UTSW	4	88348889	missense	unknown
R0617:Focad	UTSW	4	88121288	unclassified	probably benign
R0688:Focad	UTSW	4	88274213	missense	unknown
R0746:Focad	UTSW	4	88397214	missense	possibly damaging	0.84
R0907:Focad	UTSW	4	88278261	critical splice donor site	probably null
R1109:Focad	UTSW	4	88196747	intron	probably benign
R1136:Focad	UTSW	4	88326180	missense	unknown
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1412:Focad	UTSW	4	88278261	critical splice donor site	probably null
R1453:Focad	UTSW	4	88357442	critical splice acceptor site	probably null
R1697:Focad	UTSW	4	88408988	missense	probably damaging	0.98
R1739:Focad	UTSW	4	88397891	missense	probably benign	0.05
R1767:Focad	UTSW	4	88357468	missense	unknown
R1827:Focad	UTSW	4	88229383	missense	probably benign	0.03
R1866:Focad	UTSW	4	88407165	missense	possibly damaging	0.92
R1867:Focad	UTSW	4	88178089	missense	probably damaging	0.99
R1929:Focad	UTSW	4	88397179	missense	probably benign	0.32
R1929:Focad	UTSW	4	88342212	missense	unknown
R1937:Focad	UTSW	4	88401081	start codon destroyed	probably null
R1989:Focad	UTSW	4	88232784	critical splice donor site	probably null
R2176:Focad	UTSW	4	88279244	missense	unknown
R2393:Focad	UTSW	4	88121330	missense	probably damaging	0.96
R2431:Focad	UTSW	4	88331027	missense	unknown
R3195:Focad	UTSW	4	88407351	missense	possibly damaging	0.85
R3196:Focad	UTSW	4	88407351	missense	possibly damaging	0.85
R3730:Focad	UTSW	4	88408925	missense	possibly damaging	0.52
R3772:Focad	UTSW	4	88336161	splice site	probably benign
R4391:Focad	UTSW	4	88185958	missense	probably damaging	1.00
R4491:Focad	UTSW	4	88359905	critical splice donor site	probably null
R4492:Focad	UTSW	4	88359905	critical splice donor site	probably null
R4703:Focad	UTSW	4	88342321	critical splice donor site	probably null
R4788:Focad	UTSW	4	88357469	missense	unknown
R4923:Focad	UTSW	4	88196846	intron	probably benign
R5026:Focad	UTSW	4	88344582	missense	unknown
R5122:Focad	UTSW	4	88407365	critical splice donor site	probably null
R5153:Focad	UTSW	4	88359884	missense	unknown
R5369:Focad	UTSW	4	88121373	splice site	probably benign
R5414:Focad	UTSW	4	88410702	utr 3 prime	probably benign
R5839:Focad	UTSW	4	88196846	intron	probably benign
R5916:Focad	UTSW	4	88357541	missense	unknown
R5953:Focad	UTSW	4	88229335	missense	probably benign	0.01
R5991:Focad	UTSW	4	88401019	missense	possibly damaging	0.91
R6230:Focad	UTSW	4	88342204	missense	unknown
R6247:Focad	UTSW	4	88407140	missense	possibly damaging	0.92
R6324:Focad	UTSW	4	88401068	nonsense	probably null
R6543:Focad	UTSW	4	88279256	missense	unknown
R6639:Focad	UTSW	4	88278242	missense	unknown
R6802:Focad	UTSW	4	88274203	missense	unknown
R6802:Focad	UTSW	4	88344684	missense	unknown
R6866:Focad	UTSW	4	88403386	missense	probably benign	0.34
R6902:Focad	UTSW	4	88230476	missense	unknown
R6928:Focad	UTSW	4	88348875	missense	unknown
R7036:Focad	UTSW	4	88124637	missense	probably benign	0.05
R7057:Focad	UTSW	4	88274105	missense	unknown
R7077:Focad	UTSW	4	88410677	missense	unknown
R7242:Focad	UTSW	4	88309906	missense	unknown
R7357:Focad	UTSW	4	88229335	missense	probably benign	0.19
R7380:Focad	UTSW	4	88274198	missense	unknown
R7427:Focad	UTSW	4	88368751	missense	unknown
R7582:Focad	UTSW	4	88229378	missense	probably benign	0.00
R7661:Focad	UTSW	4	88303535	missense	unknown
R7688:Focad	UTSW	4	88178133	missense	probably damaging	1.00
R7789:Focad	UTSW	4	88229406	missense	unknown
R7880:Focad	UTSW	4	88401170	missense	unknown
R7963:Focad	UTSW	4	88401170	missense	unknown
R7970:Focad	UTSW	4	88182616	missense	probably damaging	1.00
R8024:Focad	UTSW	4	88397000	missense	unknown
X0035:Focad	UTSW	4	88397922	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- AACACTTAACCTGCTCTGGG -3'
(R):5'- CTCAAACCACGTAGAGGAGC -3'

Sequencing Primer
(F):5'- ACACTTAACCTGCTCTGGGGTATTTG -3'
(R):5'- GGTCCCACTGCTCTAGAACACG -3'

Posted On

2019-12-20