Mutagenetix > Incidental Mutation

Incidental Mutation 'R7887:Ubr4'

609106

Institutional Source

Beutler Lab

Gene Symbol

Ubr4

Ensembl Gene

ENSMUSG00000066036

Gene Name

ubiquitin protein ligase E3 component n-recognin 4

Synonyms

LOC381562, D930005K06Rik, Zubr1, p600, 1810009A16Rik, A930005E13Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001160319.1; MGI:1916366

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139352609-139489588 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139407810 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 818 (F818L)

Ref Sequence

ENSEMBL: ENSMUSP00000095433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000147999] [ENSMUST00000165860]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000097822
AA Change: F818L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036
AA Change: F818L

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	414	425	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
low complexity region	571	588	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1642	1655	N/A	INTRINSIC
Pfam:zf-UBR	1660	1725	1.9e-9	PFAM
Blast:ZnF_C2H2	1966	1991	6e-8	BLAST
low complexity region	2268	2279	N/A	INTRINSIC
low complexity region	2502	2540	N/A	INTRINSIC
low complexity region	2725	2735	N/A	INTRINSIC
low complexity region	2818	2852	N/A	INTRINSIC
low complexity region	2887	2905	N/A	INTRINSIC
low complexity region	2928	2942	N/A	INTRINSIC
low complexity region	2945	2959	N/A	INTRINSIC
low complexity region	2966	2986	N/A	INTRINSIC
low complexity region	3063	3091	N/A	INTRINSIC
low complexity region	3329	3385	N/A	INTRINSIC
low complexity region	3776	3788	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	4364	5160	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147999

SMART Domains

Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

Domain	Start	End	E-Value	Type
low complexity region	170	226	N/A	INTRINSIC
low complexity region	617	629	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	1205	1301	4.5e-60	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000165860
AA Change: F818L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036
AA Change: F818L

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	414	425	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
low complexity region	571	588	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1642	1655	N/A	INTRINSIC
Pfam:zf-UBR	1659	1729	4e-13	PFAM
Blast:ZnF_C2H2	1966	1991	5e-8	BLAST
low complexity region	2268	2279	N/A	INTRINSIC
low complexity region	2513	2551	N/A	INTRINSIC
low complexity region	2736	2746	N/A	INTRINSIC
low complexity region	2863	2881	N/A	INTRINSIC
low complexity region	2904	2918	N/A	INTRINSIC
low complexity region	2921	2935	N/A	INTRINSIC
low complexity region	2942	2962	N/A	INTRINSIC
low complexity region	3039	3067	N/A	INTRINSIC
low complexity region	3305	3361	N/A	INTRINSIC
low complexity region	3752	3764	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	4340	5136	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (48/49)

MGI Phenotype

Strain: 5286698
Lethality: D1-D5
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh8	T	A	9: 3,385,343	I580N	probably damaging	Het
Ankrd35	C	T	3: 96,684,900	T834M	probably damaging	Het
Astn2	C	T	4: 65,644,866	V893I	possibly damaging	Het
B4galt1	A	G	4: 40,823,501	Y197H	probably benign	Het
Brdt	T	C	5: 107,359,933	S676P	possibly damaging	Het
Chrdl2	T	C	7: 100,029,250	V343A	possibly damaging	Het
Clcn3	A	T	8: 60,941,399	M59K	probably benign	Het
Cpne4	A	T	9: 105,032,791	N529I	probably damaging	Het
Crcp	G	T	5: 130,037,870	K32N	possibly damaging	Het
Ddx54	C	T	5: 120,627,203	R846C	probably damaging	Het
Dennd6a	T	C	14: 26,599,657	S118P	possibly damaging	Het
Egr3	A	G	14: 70,079,202	Y116C	probably damaging	Het
Fbxw25	A	G	9: 109,649,594		probably null	Het
Focad	T	G	4: 88,182,616	I313M	probably damaging	Het
Gm10272	C	T	10: 77,706,945	P107L	probably benign	Het
Gpr26	A	C	7: 131,966,973	I16L	probably benign	Het
Gpr39	C	A	1: 125,677,542	T69K	probably damaging	Het
Hacl1	C	T	14: 31,634,227	G97S	probably damaging	Het
Idh3b	A	C	2: 130,281,758	D136E	probably damaging	Het
Irf6	G	A	1: 193,167,732	V321M	probably damaging	Het
Klrg2	T	A	6: 38,636,571	T166S	probably damaging	Het
Lnx2	T	C	5: 147,019,043	I648V	probably damaging	Het
Mecr	A	G	4: 131,860,866		probably null	Het
Mnat1	T	A	12: 73,188,191	S205T	probably benign	Het
Mpnd	G	A	17: 56,011,097	G204D	probably benign	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Nid1	G	T	13: 13,499,733	R899L	possibly damaging	Het
Nisch	C	T	14: 31,176,695	W664*	probably null	Het
Nudt6	C	T	3: 37,412,380	V157I	possibly damaging	Het
Olfr1156	T	C	2: 87,949,880	M118V	probably damaging	Het
Olfr573-ps1	A	C	7: 102,942,151	L142R	possibly damaging	Het
Olfr949-ps1	A	T	9: 39,364,879	M107L	unknown	Het
Onecut2	T	A	18: 64,340,975	M180K	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pclo	GTCTAT	GTCTATTCTAT	5: 14,714,190		probably null	Het
Phf11d	A	G	14: 59,359,580	Y57H	probably damaging	Het
Prkaca	T	C	8: 83,986,895	V99A	probably benign	Het
Rnf144b	T	A	13: 47,239,811	C209S	probably damaging	Het
Scly	G	A	1: 91,300,641		probably null	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sphkap	T	C	1: 83,277,412	Y872C	probably benign	Het
Ssh1	C	T	5: 113,961,349		probably null	Het
Strap	T	G	6: 137,739,809	L129V	possibly damaging	Het
Sympk	T	C	7: 19,034,439	I111T	possibly damaging	Het
Tprn	C	A	2: 25,264,012	A442E	probably damaging	Het
Tsen34	T	C	7: 3,694,708	L36P	probably damaging	Het
Uggt1	T	C	1: 36,208,034	Y294C	probably damaging	Het
Usp20	A	G	2: 31,020,894	K862E	probably benign	Het
Vmn1r201	A	T	13: 22,474,786	I57F	probably damaging	Het
Wdr64	C	T	1: 175,785,545	A662V	not run	Het

Other mutations in Ubr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ubr4	APN	4	139465322	missense	possibly damaging	0.46
IGL00336:Ubr4	APN	4	139428566	missense	probably damaging	1.00
IGL00586:Ubr4	APN	4	139455184	missense	possibly damaging	0.95
IGL00659:Ubr4	APN	4	139421245	missense	probably damaging	1.00
IGL00766:Ubr4	APN	4	139440766	missense	probably damaging	1.00
IGL00819:Ubr4	APN	4	139476282	missense	possibly damaging	0.92
IGL00833:Ubr4	APN	4	139393159	critical splice donor site	probably null
IGL01126:Ubr4	APN	4	139402555	missense	probably benign	0.04
IGL01311:Ubr4	APN	4	139479045	missense	possibly damaging	0.66
IGL01349:Ubr4	APN	4	139480728	missense	unknown
IGL01388:Ubr4	APN	4	139460243	missense	possibly damaging	0.76
IGL01417:Ubr4	APN	4	139410800	missense	probably damaging	0.99
IGL01446:Ubr4	APN	4	139438040	splice site	probably benign
IGL01449:Ubr4	APN	4	139412736	missense	probably damaging	0.98
IGL01545:Ubr4	APN	4	139442829	splice site	probably benign
IGL01568:Ubr4	APN	4	139421373	missense	probably damaging	1.00
IGL01596:Ubr4	APN	4	139462534	splice site	probably benign
IGL01621:Ubr4	APN	4	139440783	nonsense	probably null
IGL01639:Ubr4	APN	4	139417344	missense	probably damaging	0.99
IGL01655:Ubr4	APN	4	139407796	missense	probably damaging	1.00
IGL01710:Ubr4	APN	4	139418461	missense	possibly damaging	0.81
IGL01830:Ubr4	APN	4	139472500	missense	probably damaging	0.99
IGL01862:Ubr4	APN	4	139477158	missense	possibly damaging	0.66
IGL01868:Ubr4	APN	4	139412678	nonsense	probably null
IGL01874:Ubr4	APN	4	139393289	splice site	probably benign
IGL01889:Ubr4	APN	4	139462472	nonsense	probably null
IGL01891:Ubr4	APN	4	139436260	critical splice donor site	probably null
IGL01980:Ubr4	APN	4	139429602	missense	probably damaging	0.99
IGL02126:Ubr4	APN	4	139452741	critical splice donor site	probably null
IGL02153:Ubr4	APN	4	139460160	nonsense	probably null
IGL02173:Ubr4	APN	4	139437070	splice site	probably null
IGL02214:Ubr4	APN	4	139428583	missense	possibly damaging	0.95
IGL02214:Ubr4	APN	4	139461827	critical splice acceptor site	probably null
IGL02220:Ubr4	APN	4	139388435	missense	probably benign	0.01
IGL02246:Ubr4	APN	4	139459103	missense	possibly damaging	0.89
IGL02264:Ubr4	APN	4	139455628	nonsense	probably null
IGL02273:Ubr4	APN	4	139472578	missense	possibly damaging	0.94
IGL02316:Ubr4	APN	4	139473178	missense	possibly damaging	0.46
IGL02328:Ubr4	APN	4	139478922	missense	probably damaging	0.97
IGL02476:Ubr4	APN	4	139421249	nonsense	probably null
IGL02477:Ubr4	APN	4	139436205	missense	probably damaging	0.98
IGL02544:Ubr4	APN	4	139415118	missense	probably damaging	1.00
IGL02622:Ubr4	APN	4	139467250	nonsense	probably null
IGL02679:Ubr4	APN	4	139459134	missense	probably damaging	0.99
IGL02728:Ubr4	APN	4	139468811	missense	probably damaging	1.00
IGL02754:Ubr4	APN	4	139410784	missense	probably damaging	0.99
IGL02754:Ubr4	APN	4	139393159	critical splice donor site	probably null
IGL02892:Ubr4	APN	4	139417331	missense	probably damaging	0.96
IGL02897:Ubr4	APN	4	139472508	missense	probably damaging	0.97
IGL02946:Ubr4	APN	4	139425295	missense	probably damaging	1.00
IGL02964:Ubr4	APN	4	139407820	missense	possibly damaging	0.84
IGL03059:Ubr4	APN	4	139480676	missense	probably damaging	0.98
IGL03068:Ubr4	APN	4	139409730	missense	probably benign	0.02
IGL03087:Ubr4	APN	4	139450357	nonsense	probably null
IGL03116:Ubr4	APN	4	139479581	splice site	probably benign
IGL03212:Ubr4	APN	4	139409763	missense	probably benign	0.13
IGL03228:Ubr4	APN	4	139429598	missense	probably damaging	1.00
IGL03292:Ubr4	APN	4	139440435	missense	probably damaging	1.00
IGL03388:Ubr4	APN	4	139415032	missense	probably damaging	0.98
IGL03393:Ubr4	APN	4	139452678	missense	probably damaging	1.00
IGL03409:Ubr4	APN	4	139399929	nonsense	probably null
Aqua_regia	UTSW	4	139452719	nonsense	probably null
Eats	UTSW	4	139463575	missense	probably damaging	0.97
Hardened	UTSW	4	139468847	missense	probably damaging	1.00
Stoney	UTSW	4	139444687	missense	probably damaging	1.00
Uber	UTSW	4	139479062	critical splice donor site	probably null
BB001:Ubr4	UTSW	4	139467276	missense	unknown
BB011:Ubr4	UTSW	4	139467276	missense	unknown
P0019:Ubr4	UTSW	4	139451781	missense	probably damaging	1.00
PIT4544001:Ubr4	UTSW	4	139402560	missense	possibly damaging	0.93
R0001:Ubr4	UTSW	4	139451788	missense	probably damaging	1.00
R0002:Ubr4	UTSW	4	139390900	missense	probably damaging	1.00
R0006:Ubr4	UTSW	4	139431649	missense	probably benign	0.03
R0006:Ubr4	UTSW	4	139431649	missense	probably benign	0.03
R0008:Ubr4	UTSW	4	139430176	missense	probably damaging	1.00
R0027:Ubr4	UTSW	4	139400393	missense	probably damaging	0.99
R0027:Ubr4	UTSW	4	139400393	missense	probably damaging	0.99
R0030:Ubr4	UTSW	4	139426793	missense	probably damaging	1.00
R0044:Ubr4	UTSW	4	139437058	splice site	probably benign
R0044:Ubr4	UTSW	4	139437058	splice site	probably benign
R0088:Ubr4	UTSW	4	139440814	missense	probably damaging	1.00
R0131:Ubr4	UTSW	4	139464051	missense	possibly damaging	0.66
R0184:Ubr4	UTSW	4	139445262	missense	probably damaging	1.00
R0219:Ubr4	UTSW	4	139430257	missense	possibly damaging	0.64
R0227:Ubr4	UTSW	4	139431649	missense	probably benign	0.03
R0270:Ubr4	UTSW	4	139479435	splice site	probably benign
R0285:Ubr4	UTSW	4	139440801	missense	probably damaging	1.00
R0322:Ubr4	UTSW	4	139422418	missense	probably damaging	1.00
R0363:Ubr4	UTSW	4	139391860	missense	probably damaging	0.98
R0393:Ubr4	UTSW	4	139410860	splice site	probably benign
R0450:Ubr4	UTSW	4	139430223	missense	probably benign	0.14
R0504:Ubr4	UTSW	4	139406578	missense	probably damaging	1.00
R0504:Ubr4	UTSW	4	139480838	critical splice donor site	probably null
R0510:Ubr4	UTSW	4	139430223	missense	probably benign	0.14
R0513:Ubr4	UTSW	4	139416875	missense	possibly damaging	0.74
R0517:Ubr4	UTSW	4	139392124	missense	probably benign	0.00
R0558:Ubr4	UTSW	4	139426902	missense	probably benign	0.09
R0617:Ubr4	UTSW	4	139479062	critical splice donor site	probably null
R0636:Ubr4	UTSW	4	139436302	splice site	probably null
R0637:Ubr4	UTSW	4	139399615	missense	probably damaging	1.00
R0652:Ubr4	UTSW	4	139401326	missense	probably damaging	0.99
R0691:Ubr4	UTSW	4	139423906	missense	probably damaging	1.00
R0729:Ubr4	UTSW	4	139485320	missense	possibly damaging	0.66
R0735:Ubr4	UTSW	4	139428028	splice site	probably null
R0751:Ubr4	UTSW	4	139437198	splice site	probably benign
R0789:Ubr4	UTSW	4	139410271	critical splice donor site	probably null
R0825:Ubr4	UTSW	4	139479576	critical splice donor site	probably null
R0828:Ubr4	UTSW	4	139450553	splice site	probably benign
R1052:Ubr4	UTSW	4	139455460	missense	possibly damaging	0.83
R1184:Ubr4	UTSW	4	139437198	splice site	probably benign
R1222:Ubr4	UTSW	4	139388471	splice site	probably null
R1258:Ubr4	UTSW	4	139426914	missense	probably damaging	1.00
R1321:Ubr4	UTSW	4	139460123	missense	possibly damaging	0.46
R1385:Ubr4	UTSW	4	139402612	missense	probably benign	0.00
R1450:Ubr4	UTSW	4	139468028	missense	probably damaging	1.00
R1470:Ubr4	UTSW	4	139421226	splice site	probably null
R1470:Ubr4	UTSW	4	139421226	splice site	probably null
R1474:Ubr4	UTSW	4	139429579	missense	probably damaging	1.00
R1479:Ubr4	UTSW	4	139425840	missense	possibly damaging	0.95
R1534:Ubr4	UTSW	4	139428151	missense	possibly damaging	0.95
R1546:Ubr4	UTSW	4	139416927	nonsense	probably null
R1785:Ubr4	UTSW	4	139423945	missense	probably damaging	1.00
R1786:Ubr4	UTSW	4	139423945	missense	probably damaging	1.00
R1789:Ubr4	UTSW	4	139393053	missense	probably damaging	1.00
R1796:Ubr4	UTSW	4	139428596	missense	probably benign	0.25
R1800:Ubr4	UTSW	4	139407963	missense	probably damaging	0.99
R1801:Ubr4	UTSW	4	139452563	splice site	probably null
R1827:Ubr4	UTSW	4	139425697	critical splice acceptor site	probably null
R1887:Ubr4	UTSW	4	139455560	missense	probably damaging	1.00
R1966:Ubr4	UTSW	4	139451244	critical splice acceptor site	probably null
R2010:Ubr4	UTSW	4	139480652	missense	possibly damaging	0.92
R2049:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2069:Ubr4	UTSW	4	139479540	missense	possibly damaging	0.66
R2114:Ubr4	UTSW	4	139429611	nonsense	probably null
R2140:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2141:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2142:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2168:Ubr4	UTSW	4	139410649	missense	probably benign	0.25
R2237:Ubr4	UTSW	4	139442790	missense	probably damaging	1.00
R2249:Ubr4	UTSW	4	139448921	missense	probably damaging	1.00
R2261:Ubr4	UTSW	4	139413462	missense	probably damaging	0.99
R2264:Ubr4	UTSW	4	139420373	splice site	probably benign
R2353:Ubr4	UTSW	4	139433673	missense	possibly damaging	0.48
R2437:Ubr4	UTSW	4	139473542	missense	possibly damaging	0.90
R2496:Ubr4	UTSW	4	139473205	unclassified	probably benign
R2896:Ubr4	UTSW	4	139455644	splice site	probably null
R2922:Ubr4	UTSW	4	139479500	missense	possibly damaging	0.66
R2972:Ubr4	UTSW	4	139406536	missense	probably benign	0.22
R2973:Ubr4	UTSW	4	139406536	missense	probably benign	0.22
R2989:Ubr4	UTSW	4	139463558	missense	possibly damaging	0.89
R3176:Ubr4	UTSW	4	139421855	missense	probably benign	0.03
R3276:Ubr4	UTSW	4	139421855	missense	probably benign	0.03
R3772:Ubr4	UTSW	4	139452700	missense	possibly damaging	0.89
R3844:Ubr4	UTSW	4	139459126	missense	probably damaging	0.99
R3873:Ubr4	UTSW	4	139423990	missense	probably damaging	1.00
R3900:Ubr4	UTSW	4	139479062	critical splice donor site	probably null
R3951:Ubr4	UTSW	4	139393094	missense	probably damaging	1.00
R4020:Ubr4	UTSW	4	139451805	missense	probably damaging	0.98
R4178:Ubr4	UTSW	4	139393414	missense	probably damaging	1.00
R4308:Ubr4	UTSW	4	139472509	missense	possibly damaging	0.46
R4378:Ubr4	UTSW	4	139410440	missense	possibly damaging	0.76
R4400:Ubr4	UTSW	4	139461856	missense	possibly damaging	0.66
R4421:Ubr4	UTSW	4	139461856	missense	possibly damaging	0.66
R4462:Ubr4	UTSW	4	139418502	missense	possibly damaging	0.47
R4583:Ubr4	UTSW	4	139380853	missense	possibly damaging	0.82
R4611:Ubr4	UTSW	4	139399579	missense	possibly damaging	0.93
R4664:Ubr4	UTSW	4	139406518	missense	possibly damaging	0.56
R4671:Ubr4	UTSW	4	139436191	missense	possibly damaging	0.66
R4672:Ubr4	UTSW	4	139410716	missense	probably damaging	0.99
R4673:Ubr4	UTSW	4	139410716	missense	probably damaging	0.99
R4696:Ubr4	UTSW	4	139408672	missense	probably benign	0.09
R4701:Ubr4	UTSW	4	139471336	missense	possibly damaging	0.66
R4705:Ubr4	UTSW	4	139450529	missense	probably damaging	1.00
R4726:Ubr4	UTSW	4	139482579	missense	possibly damaging	0.46
R4728:Ubr4	UTSW	4	139423879	missense	probably damaging	1.00
R4783:Ubr4	UTSW	4	139421733	missense	possibly damaging	0.85
R4833:Ubr4	UTSW	4	139402546	missense	probably damaging	0.98
R4892:Ubr4	UTSW	4	139428517	missense	probably benign	0.14
R4936:Ubr4	UTSW	4	139396566	missense	probably damaging	0.98
R5000:Ubr4	UTSW	4	139436169	missense	probably damaging	0.98
R5114:Ubr4	UTSW	4	139410623	missense	probably damaging	0.99
R5189:Ubr4	UTSW	4	139410649	missense	probably benign	0.25
R5197:Ubr4	UTSW	4	139468097	missense	probably damaging	1.00
R5213:Ubr4	UTSW	4	139402566	nonsense	probably null
R5219:Ubr4	UTSW	4	139477232	nonsense	probably null
R5346:Ubr4	UTSW	4	139428491	missense	probably damaging	0.97
R5368:Ubr4	UTSW	4	139397528	intron	probably benign
R5442:Ubr4	UTSW	4	139407772	missense	probably damaging	1.00
R5527:Ubr4	UTSW	4	139480788	missense	possibly damaging	0.83
R5548:Ubr4	UTSW	4	139460090	missense	probably damaging	0.97
R5568:Ubr4	UTSW	4	139392038	missense	probably damaging	0.99
R5639:Ubr4	UTSW	4	139452648	missense	possibly damaging	0.66
R5643:Ubr4	UTSW	4	139444687	missense	probably damaging	1.00
R5663:Ubr4	UTSW	4	139428583	missense	possibly damaging	0.95
R5755:Ubr4	UTSW	4	139460095	missense	possibly damaging	0.66
R5781:Ubr4	UTSW	4	139468096	missense	probably damaging	1.00
R5784:Ubr4	UTSW	4	139425218	missense	probably damaging	1.00
R5817:Ubr4	UTSW	4	139468847	missense	probably damaging	1.00
R5872:Ubr4	UTSW	4	139425330	missense	probably damaging	0.98
R5891:Ubr4	UTSW	4	139408626	nonsense	probably null
R5901:Ubr4	UTSW	4	139451254	missense	probably damaging	1.00
R5958:Ubr4	UTSW	4	139455638	missense	probably damaging	1.00
R5974:Ubr4	UTSW	4	139421078	splice site	probably null
R6065:Ubr4	UTSW	4	139421238	missense	probably damaging	1.00
R6109:Ubr4	UTSW	4	139417364	missense	probably damaging	0.99
R6207:Ubr4	UTSW	4	139421248	missense	probably damaging	1.00
R6265:Ubr4	UTSW	4	139452640	missense	possibly damaging	0.90
R6319:Ubr4	UTSW	4	139408889	missense	possibly damaging	0.84
R6342:Ubr4	UTSW	4	139429539	missense	possibly damaging	0.88
R6434:Ubr4	UTSW	4	139429638	missense	probably damaging	1.00
R6437:Ubr4	UTSW	4	139397214	critical splice donor site	probably null
R6481:Ubr4	UTSW	4	139431751	missense	probably damaging	0.97
R6502:Ubr4	UTSW	4	139444671	missense	probably damaging	1.00
R6546:Ubr4	UTSW	4	139414394	missense	probably damaging	0.99
R6603:Ubr4	UTSW	4	139455586	missense	probably benign	0.17
R6648:Ubr4	UTSW	4	139452719	nonsense	probably null
R6649:Ubr4	UTSW	4	139473624	missense	possibly damaging	0.66
R6653:Ubr4	UTSW	4	139473624	missense	possibly damaging	0.66
R6668:Ubr4	UTSW	4	139465341	missense	probably damaging	1.00
R6770:Ubr4	UTSW	4	139489182	missense	unknown
R6772:Ubr4	UTSW	4	139467230	nonsense	probably null
R6857:Ubr4	UTSW	4	139486051	missense	possibly damaging	0.90
R6869:Ubr4	UTSW	4	139467227	missense	possibly damaging	0.93
R6912:Ubr4	UTSW	4	139458234	critical splice donor site	probably null
R6943:Ubr4	UTSW	4	139437131	nonsense	probably null
R6970:Ubr4	UTSW	4	139406528	nonsense	probably null
R6976:Ubr4	UTSW	4	139393077	missense	probably damaging	0.98
R7000:Ubr4	UTSW	4	139414404	missense	probably damaging	1.00
R7017:Ubr4	UTSW	4	139393090	missense	probably damaging	0.99
R7165:Ubr4	UTSW	4	139450513	missense
R7222:Ubr4	UTSW	4	139463373	missense	unknown
R7241:Ubr4	UTSW	4	139443414	missense	probably damaging	1.00
R7343:Ubr4	UTSW	4	139413438	missense	probably benign	0.09
R7367:Ubr4	UTSW	4	139452691	missense	unknown
R7393:Ubr4	UTSW	4	139426785	missense	probably damaging	1.00
R7432:Ubr4	UTSW	4	139388382	missense	probably damaging	1.00
R7448:Ubr4	UTSW	4	139462467	missense	unknown
R7502:Ubr4	UTSW	4	139412672	missense	possibly damaging	0.72
R7514:Ubr4	UTSW	4	139452655	missense	unknown
R7526:Ubr4	UTSW	4	139422417	missense	probably benign	0.00
R7529:Ubr4	UTSW	4	139422417	missense	probably benign	0.00
R7666:Ubr4	UTSW	4	139413480	missense	possibly damaging	0.81
R7699:Ubr4	UTSW	4	139408867	nonsense	probably null
R7700:Ubr4	UTSW	4	139408867	nonsense	probably null
R7726:Ubr4	UTSW	4	139458920	missense	unknown
R7753:Ubr4	UTSW	4	139470292	missense	unknown
R7810:Ubr4	UTSW	4	139415083	missense
R7837:Ubr4	UTSW	4	139393151	nonsense	probably null
R7868:Ubr4	UTSW	4	139460033	missense	unknown
R7872:Ubr4	UTSW	4	139393062	missense	possibly damaging	0.94
R7924:Ubr4	UTSW	4	139467276	missense	unknown
R7980:Ubr4	UTSW	4	139418406	missense
R7982:Ubr4	UTSW	4	139428208	critical splice donor site	probably null
R8005:Ubr4	UTSW	4	139412630	missense	probably damaging	0.98
R8054:Ubr4	UTSW	4	139468102	missense	unknown
R8094:Ubr4	UTSW	4	139440696	missense	probably damaging	0.97
R8151:Ubr4	UTSW	4	139402801	missense	probably damaging	0.97
R8183:Ubr4	UTSW	4	139482471	missense	unknown
R8252:Ubr4	UTSW	4	139473217	missense	unknown
R8505:Ubr4	UTSW	4	139429569	missense
R8519:Ubr4	UTSW	4	139416647	missense	probably damaging	0.97
R8716:Ubr4	UTSW	4	139468853	missense	unknown
R8720:Ubr4	UTSW	4	139480838	critical splice donor site	probably null
R8749:Ubr4	UTSW	4	139402624	missense	probably damaging	0.98
R8768:Ubr4	UTSW	4	139421765	missense
R8789:Ubr4	UTSW	4	139410183	missense	possibly damaging	0.76
R8879:Ubr4	UTSW	4	139410518	missense	probably benign	0.06
R8937:Ubr4	UTSW	4	139463575	missense	probably damaging	0.97
R9006:Ubr4	UTSW	4	139444692	critical splice donor site	probably null
R9116:Ubr4	UTSW	4	139418474	missense
R9134:Ubr4	UTSW	4	139400444	critical splice donor site	probably null
R9251:Ubr4	UTSW	4	139450325	missense
R9340:Ubr4	UTSW	4	139455452	missense	unknown
R9384:Ubr4	UTSW	4	139467320	missense	unknown
R9389:Ubr4	UTSW	4	139425924	missense
R9393:Ubr4	UTSW	4	139485302	missense	unknown
R9531:Ubr4	UTSW	4	139407906	missense	probably benign	0.00
R9573:Ubr4	UTSW	4	139421139	missense
R9604:Ubr4	UTSW	4	139432516	critical splice donor site	probably null
R9613:Ubr4	UTSW	4	139421762	missense
R9623:Ubr4	UTSW	4	139431713	missense	probably benign	0.00
R9651:Ubr4	UTSW	4	139479548	missense	unknown
R9685:Ubr4	UTSW	4	139464030	missense	unknown
R9698:Ubr4	UTSW	4	139440664	missense
R9700:Ubr4	UTSW	4	139392077	missense	probably damaging	0.97
R9727:Ubr4	UTSW	4	139413424	missense	probably damaging	0.98
R9766:Ubr4	UTSW	4	139467284	missense	unknown
T0975:Ubr4	UTSW	4	139451781	missense	probably damaging	1.00
X0028:Ubr4	UTSW	4	139410271	critical splice donor site	probably null
Z1176:Ubr4	UTSW	4	139400385	missense	probably damaging	1.00
Z1176:Ubr4	UTSW	4	139402660	missense	probably benign	0.04
Z1176:Ubr4	UTSW	4	139410145	missense	probably damaging	1.00
Z1177:Ubr4	UTSW	4	139450481	missense
Z1186:Ubr4	UTSW	4	139410653	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCGCAGCATTAGGAGTTGCG -3'
(R):5'- GCTCTTGGCAGGAGAACAAG -3'

Sequencing Primer
(F):5'- CAGCATTAGGAGTTGCGGTCTTG -3'
(R):5'- GGGTCTTCACCTGCTCAAACAG -3'

Posted On

2019-12-20