Incidental Mutation 'R7887:Ddx54'
ID609111
Institutional Source Beutler Lab
Gene Symbol Ddx54
Ensembl Gene ENSMUSG00000029599
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Synonyms2410015A15Rik, APR-5, DP97
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7887 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location120612739-120628592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120627203 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 846 (R846C)
Ref Sequence ENSEMBL: ENSMUSP00000031598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031598] [ENSMUST00000177908]
Predicted Effect probably damaging
Transcript: ENSMUST00000031598
AA Change: R846C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031598
Gene: ENSMUSG00000029599
AA Change: R846C

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Blast:DEXDc 59 101 9e-19 BLAST
DEXDc 114 313 3.5e-58 SMART
HELICc 347 432 7.86e-20 SMART
low complexity region 628 646 N/A INTRINSIC
DBP10CT 706 766 1.45e-25 SMART
low complexity region 778 801 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177908
SMART Domains Protein: ENSMUSP00000137554
Gene: ENSMUSG00000094282

DomainStartEndE-ValueType
Pfam:DUF4200 35 151 2.1e-25 PFAM
coiled coil region 185 231 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The nucleolar protein encoded by this gene interacts in a hormone-dependent manner with nuclear receptors, and represses their transcriptional activity. Alternative splice variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Ddx54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Ddx54 APN 5 120623810 critical splice donor site probably null
IGL01324:Ddx54 APN 5 120623638 missense probably benign 0.00
IGL01399:Ddx54 APN 5 120623903 nonsense probably null
IGL02052:Ddx54 APN 5 120625718 missense possibly damaging 0.93
IGL02095:Ddx54 APN 5 120623791 missense possibly damaging 0.81
IGL02370:Ddx54 APN 5 120619787 missense probably damaging 1.00
IGL02861:Ddx54 APN 5 120618130 splice site probably benign
R0521:Ddx54 UTSW 5 120626862 missense probably benign 0.00
R0556:Ddx54 UTSW 5 120619654 splice site probably benign
R0723:Ddx54 UTSW 5 120623638 missense probably benign 0.00
R2968:Ddx54 UTSW 5 120618629 missense probably damaging 1.00
R4622:Ddx54 UTSW 5 120626423 missense probably damaging 1.00
R4853:Ddx54 UTSW 5 120623629 missense probably benign 0.12
R5168:Ddx54 UTSW 5 120617032 missense probably benign 0.00
R5169:Ddx54 UTSW 5 120623263 missense probably damaging 1.00
R5424:Ddx54 UTSW 5 120619861 critical splice donor site probably null
R5489:Ddx54 UTSW 5 120624721 missense probably benign
R5956:Ddx54 UTSW 5 120626367 unclassified probably benign
R5999:Ddx54 UTSW 5 120623580 missense probably benign 0.00
R6220:Ddx54 UTSW 5 120620689 missense probably benign 0.09
R6413:Ddx54 UTSW 5 120627062 missense probably benign
R6477:Ddx54 UTSW 5 120621778 missense probably damaging 1.00
R6702:Ddx54 UTSW 5 120626503 missense possibly damaging 0.52
R6783:Ddx54 UTSW 5 120618714 nonsense probably null
R6865:Ddx54 UTSW 5 120621827 critical splice donor site probably null
R7258:Ddx54 UTSW 5 120620747 missense probably damaging 1.00
R7260:Ddx54 UTSW 5 120626920 missense probably benign 0.21
R7488:Ddx54 UTSW 5 120624724 missense probably benign
R8179:Ddx54 UTSW 5 120627102 missense probably benign
R8303:Ddx54 UTSW 5 120621790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAAGCGAGGTCGTAGTC -3'
(R):5'- GGATCTTCCAACAGCACATGG -3'

Sequencing Primer
(F):5'- TCGTAGTCAAGGTGGGCAG -3'
(R):5'- GGACATAGTCCCTGACGTCCAC -3'
Posted On2019-12-20