Mutagenetix > Incidental Mutation

Incidental Mutation 'R7887:Tsen34'

609116

Institutional Source

Beutler Lab

Gene Symbol

Tsen34

Ensembl Gene

ENSMUSG00000035585

Gene Name

tRNA splicing endonuclease subunit 34

Synonyms

Leng5, 0610027F08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.910) question?

Stock #

R7887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3692863-3701024 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3694708 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 36 (L36P)

Ref Sequence

ENSEMBL: ENSMUSP00000104267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038521] [ENSMUST00000038608] [ENSMUST00000108627] [ENSMUST00000108629] [ENSMUST00000108630] [ENSMUST00000118710] [ENSMUST00000123088] [ENSMUST00000127106] [ENSMUST00000128364] [ENSMUST00000137204] [ENSMUST00000142713] [ENSMUST00000155060] [ENSMUST00000205287] [ENSMUST00000205734] [ENSMUST00000206343] [ENSMUST00000206379] [ENSMUST00000206571]

AlphaFold

Q8BMZ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000038521
AA Change: L36P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046911
Gene: ENSMUSG00000035585
AA Change: L36P

Domain	Start	End	E-Value	Type
low complexity region	45	61	N/A	INTRINSIC
Pfam:tRNA_int_endo	219	303	2.9e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000038608

SMART Domains

Protein: ENSMUSP00000037107
Gene: ENSMUSG00000035596

Domain	Start	End	E-Value	Type
transmembrane domain	5	22	N/A	INTRINSIC
Pfam:MBOAT	57	420	2.4e-37	PFAM
transmembrane domain	425	447	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108627
AA Change: L36P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104267
Gene: ENSMUSG00000035585
AA Change: L36P

Domain	Start	End	E-Value	Type
low complexity region	45	61	N/A	INTRINSIC
Pfam:tRNA_int_endo	223	307	4.8e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108629
AA Change: L36P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104269
Gene: ENSMUSG00000035585
AA Change: L36P

Domain	Start	End	E-Value	Type
low complexity region	45	61	N/A	INTRINSIC
Pfam:tRNA_int_endo	223	256	3.7e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108630
AA Change: L36P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104270
Gene: ENSMUSG00000035585
AA Change: L36P

Domain	Start	End	E-Value	Type
low complexity region	45	61	N/A	INTRINSIC
Pfam:tRNA_int_endo	223	307	7.9e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118710

SMART Domains

Protein: ENSMUSP00000112710
Gene: ENSMUSG00000035596

Domain	Start	End	E-Value	Type
transmembrane domain	5	22	N/A	INTRINSIC
transmembrane domain	35	57	N/A	INTRINSIC
Pfam:MBOAT	86	343	1.5e-32	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000123088
AA Change: L36P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123614
Gene: ENSMUSG00000035585
AA Change: L36P

Domain	Start	End	E-Value	Type
low complexity region	45	61	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127106

SMART Domains

Protein: ENSMUSP00000116446
Gene: ENSMUSG00000035596

Domain	Start	End	E-Value	Type
transmembrane domain	5	22	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128364

SMART Domains

Protein: ENSMUSP00000120521
Gene: ENSMUSG00000035596

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	32	46	N/A	INTRINSIC
low complexity region	58	67	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137204
AA Change: L60P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120403
Gene: ENSMUSG00000035585
AA Change: L60P

Domain	Start	End	E-Value	Type
low complexity region	69	85	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000142713
AA Change: L36P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118440
Gene: ENSMUSG00000035585
AA Change: L36P

Domain	Start	End	E-Value	Type
low complexity region	45	61	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147288

Predicted Effect

probably damaging
Transcript: ENSMUST00000155060
AA Change: L36P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118816
Gene: ENSMUSG00000035585
AA Change: L36P

Domain	Start	End	E-Value	Type
low complexity region	45	61	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000205287
AA Change: L36P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000205734
AA Change: L53P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000206343

Predicted Effect

probably benign
Transcript: ENSMUST00000206379

Predicted Effect

probably benign
Transcript: ENSMUST00000206571

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a catalytic subunit of the tRNA splicing endonuclease, which catalyzes the removal of introns from precursor tRNAs. The endonuclease complex is also associated with a pre-mRNA 3-prime end processing factor. A mutation in this gene results in the neurological disorder pontocerebellar hypoplasia type 2. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh8	T	A	9: 3,385,343	I580N	probably damaging	Het
Ankrd35	C	T	3: 96,684,900	T834M	probably damaging	Het
Astn2	C	T	4: 65,644,866	V893I	possibly damaging	Het
B4galt1	A	G	4: 40,823,501	Y197H	probably benign	Het
Brdt	T	C	5: 107,359,933	S676P	possibly damaging	Het
Chrdl2	T	C	7: 100,029,250	V343A	possibly damaging	Het
Clcn3	A	T	8: 60,941,399	M59K	probably benign	Het
Cpne4	A	T	9: 105,032,791	N529I	probably damaging	Het
Crcp	G	T	5: 130,037,870	K32N	possibly damaging	Het
Ddx54	C	T	5: 120,627,203	R846C	probably damaging	Het
Dennd6a	T	C	14: 26,599,657	S118P	possibly damaging	Het
Egr3	A	G	14: 70,079,202	Y116C	probably damaging	Het
Fbxw25	A	G	9: 109,649,594		probably null	Het
Focad	T	G	4: 88,182,616	I313M	probably damaging	Het
Gm10272	C	T	10: 77,706,945	P107L	probably benign	Het
Gpr26	A	C	7: 131,966,973	I16L	probably benign	Het
Gpr39	C	A	1: 125,677,542	T69K	probably damaging	Het
Hacl1	C	T	14: 31,634,227	G97S	probably damaging	Het
Idh3b	A	C	2: 130,281,758	D136E	probably damaging	Het
Irf6	G	A	1: 193,167,732	V321M	probably damaging	Het
Klrg2	T	A	6: 38,636,571	T166S	probably damaging	Het
Lnx2	T	C	5: 147,019,043	I648V	probably damaging	Het
Mecr	A	G	4: 131,860,866		probably null	Het
Mnat1	T	A	12: 73,188,191	S205T	probably benign	Het
Mpnd	G	A	17: 56,011,097	G204D	probably benign	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Nid1	G	T	13: 13,499,733	R899L	possibly damaging	Het
Nisch	C	T	14: 31,176,695	W664*	probably null	Het
Nudt6	C	T	3: 37,412,380	V157I	possibly damaging	Het
Olfr1156	T	C	2: 87,949,880	M118V	probably damaging	Het
Olfr573-ps1	A	C	7: 102,942,151	L142R	possibly damaging	Het
Olfr949-ps1	A	T	9: 39,364,879	M107L	unknown	Het
Onecut2	T	A	18: 64,340,975	M180K	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pclo	GTCTAT	GTCTATTCTAT	5: 14,714,190		probably null	Het
Phf11d	A	G	14: 59,359,580	Y57H	probably damaging	Het
Prkaca	T	C	8: 83,986,895	V99A	probably benign	Het
Rnf144b	T	A	13: 47,239,811	C209S	probably damaging	Het
Scly	G	A	1: 91,300,641		probably null	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sphkap	T	C	1: 83,277,412	Y872C	probably benign	Het
Ssh1	C	T	5: 113,961,349		probably null	Het
Strap	T	G	6: 137,739,809	L129V	possibly damaging	Het
Sympk	T	C	7: 19,034,439	I111T	possibly damaging	Het
Tprn	C	A	2: 25,264,012	A442E	probably damaging	Het
Ubr4	T	C	4: 139,407,810	F818L	probably damaging	Het
Uggt1	T	C	1: 36,208,034	Y294C	probably damaging	Het
Usp20	A	G	2: 31,020,894	K862E	probably benign	Het
Vmn1r201	A	T	13: 22,474,786	I57F	probably damaging	Het
Wdr64	C	T	1: 175,785,545	A662V	not run	Het

Other mutations in Tsen34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Tsen34	APN	7	3700531	makesense	probably null
R1612:Tsen34	UTSW	7	3695396	missense	probably damaging	0.99
R2441:Tsen34	UTSW	7	3694995	missense	possibly damaging	0.92
R4455:Tsen34	UTSW	7	3695098	splice site	probably null
R4702:Tsen34	UTSW	7	3700633	missense	probably damaging	1.00
R4870:Tsen34	UTSW	7	3694381	unclassified	probably benign
R5950:Tsen34	UTSW	7	3694788	missense	probably null	0.97
R6221:Tsen34	UTSW	7	3695544	missense	probably damaging	0.99
R6266:Tsen34	UTSW	7	3693985	unclassified	probably benign
R7121:Tsen34	UTSW	7	3694987	missense	probably benign	0.18
R7134:Tsen34	UTSW	7	3700641	missense	probably damaging	0.98
R7190:Tsen34	UTSW	7	3694807	missense	possibly damaging	0.94
R7345:Tsen34	UTSW	7	3695615	missense	probably damaging	1.00
R7448:Tsen34	UTSW	7	3695835	critical splice donor site	probably null
R7743:Tsen34	UTSW	7	3694602	missense	possibly damaging	0.54
R8723:Tsen34	UTSW	7	3695150	missense	probably benign	0.00
R8916:Tsen34	UTSW	7	3694341	unclassified	probably benign
RF020:Tsen34	UTSW	7	3695796	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TAACTGGTCCCTGGGTAGATC -3'
(R):5'- GTTTACAACCTTCCAACAGGC -3'

Sequencing Primer
(F):5'- CTGAGGGCGTGGAAGACTTC -3'
(R):5'- TTCCAACAGGCCCTCCCAG -3'

Posted On

2019-12-20