Incidental Mutation 'R7887:Chrdl2'
ID609118
Institutional Source Beutler Lab
Gene Symbol Chrdl2
Ensembl Gene ENSMUSG00000030732
Gene Namechordin-like 2
Synonyms1810022C01Rik, Chl2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R7887 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location100006172-100034728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100029250 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 343 (V343A)
Ref Sequence ENSEMBL: ENSMUSP00000102699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032977] [ENSMUST00000107084]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032977
AA Change: V336A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032977
Gene: ENSMUSG00000030732
AA Change: V336A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 33 95 1.13e-3 SMART
VWC 111 174 1.58e-1 SMART
low complexity region 207 219 N/A INTRINSIC
VWC 248 310 3.09e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107084
AA Change: V343A

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102699
Gene: ENSMUSG00000030732
AA Change: V343A

DomainStartEndE-ValueType
VWC 40 102 1.13e-3 SMART
VWC 118 181 1.58e-1 SMART
low complexity region 214 226 N/A INTRINSIC
VWC 255 317 3.09e-10 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000120760
Gene: ENSMUSG00000030732
AA Change: V130A

DomainStartEndE-ValueType
Blast:VWC 2 34 2e-15 BLAST
low complexity region 67 79 N/A INTRINSIC
low complexity region 96 114 N/A INTRINSIC
Meta Mutation Damage Score 0.1075 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chordin family of proteins. Chordin family members are secreted proteins that share a cysteine-rich pro-collagen repeat domain and associate with members of the transforming growth factor beta superfamily. In vitro assays demonstrate a direct interaction between the encoded protein and human activin A. This gene is expressed in many tissues including osteoblasts, where it is differentially expressed during differentiation. In addition, its expression is upregulated in human osteoarthritic joint cartilage, suggesting a role in adult cartilage regeneration. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Chrdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Chrdl2 APN 7 100034641 missense probably damaging 0.96
IGL00965:Chrdl2 APN 7 100006653 splice site probably null
IGL01320:Chrdl2 APN 7 100017041 missense probably damaging 1.00
IGL01322:Chrdl2 APN 7 100017041 missense probably damaging 1.00
IGL01977:Chrdl2 APN 7 100022056 missense probably benign 0.33
IGL02170:Chrdl2 APN 7 100034614 missense possibly damaging 0.92
IGL02478:Chrdl2 APN 7 100020983 critical splice donor site probably null
IGL02745:Chrdl2 APN 7 100020963 missense probably damaging 1.00
IGL03117:Chrdl2 APN 7 100027580 missense possibly damaging 0.83
IGL03377:Chrdl2 APN 7 100022052 missense probably benign 0.03
Measley UTSW 7 100010121 critical splice donor site probably null
R1453:Chrdl2 UTSW 7 100016990 missense possibly damaging 0.64
R1900:Chrdl2 UTSW 7 100033664 missense possibly damaging 0.75
R2092:Chrdl2 UTSW 7 100020977 nonsense probably null
R3421:Chrdl2 UTSW 7 100023868 missense probably damaging 1.00
R3949:Chrdl2 UTSW 7 100029205 missense possibly damaging 0.89
R4305:Chrdl2 UTSW 7 100022022 missense probably damaging 1.00
R4306:Chrdl2 UTSW 7 100022022 missense probably damaging 1.00
R4776:Chrdl2 UTSW 7 100006541 unclassified probably benign
R5208:Chrdl2 UTSW 7 100023922 missense probably damaging 0.96
R5327:Chrdl2 UTSW 7 100028741 missense probably damaging 1.00
R5859:Chrdl2 UTSW 7 100020907 missense probably damaging 1.00
R5928:Chrdl2 UTSW 7 100009993 start gained probably benign
R6706:Chrdl2 UTSW 7 100010121 critical splice donor site probably null
R7027:Chrdl2 UTSW 7 100022033 missense probably damaging 1.00
R7039:Chrdl2 UTSW 7 100028672 missense probably damaging 1.00
R7357:Chrdl2 UTSW 7 100029207 missense probably benign 0.00
R7468:Chrdl2 UTSW 7 100010125 splice site probably null
R7840:Chrdl2 UTSW 7 100033656 missense probably damaging 0.99
R7870:Chrdl2 UTSW 7 100010042 missense unknown
R8394:Chrdl2 UTSW 7 100017085 missense possibly damaging 0.95
R8436:Chrdl2 UTSW 7 100027733 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCAGAGGCTCTTACAGACAC -3'
(R):5'- CTAGCAACGCTTTCTTAAGGCC -3'

Sequencing Primer
(F):5'- GGCTCTTACAGACACAAAATCAAGTG -3'
(R):5'- AACGCTTTCTTAAGGCCCCTATGG -3'
Posted On2019-12-20