Incidental Mutation 'R7887:Gpr26'
ID609120
Institutional Source Beutler Lab
Gene Symbol Gpr26
Ensembl Gene ENSMUSG00000040125
Gene NameG protein-coupled receptor 26
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7887 (G1)
Quality Score217.009
Status Validated
Chromosome7
Chromosomal Location131966460-131994405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 131966973 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 16 (I16L)
Ref Sequence ENSEMBL: ENSMUSP00000041664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045840] [ENSMUST00000124096]
Predicted Effect probably benign
Transcript: ENSMUST00000045840
AA Change: I16L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041664
Gene: ENSMUSG00000040125
AA Change: I16L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 15 309 1.9e-7 PFAM
Pfam:7tm_1 22 294 1.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-couple receptor protein. G-protein-coupled receptors are a large family of membrane proteins that are involved in cellular responses to environmental stimuli, neurotransmitters, and hormones. The encoded protein may play a role in neurodegenerative diseases. Epigenetic silencing of this gene has been observed in gliomas. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit increased anxiety- and depression-related behaviors and alcohol preference. Female mice homozygous for another allele display increased susceptibility to diet-induced obesity with increased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Gpr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Gpr26 APN 7 131967501 missense probably damaging 1.00
IGL01345:Gpr26 APN 7 131967432 missense possibly damaging 0.90
IGL01658:Gpr26 APN 7 131984105 missense probably benign
IGL02724:Gpr26 APN 7 131974392 critical splice donor site probably null
R0408:Gpr26 UTSW 7 131967520 missense possibly damaging 0.81
R0408:Gpr26 UTSW 7 131974272 splice site probably null
R0547:Gpr26 UTSW 7 131984297 missense probably benign 0.01
R2508:Gpr26 UTSW 7 131967094 missense probably damaging 0.98
R4088:Gpr26 UTSW 7 131967076 missense probably benign 0.00
R4630:Gpr26 UTSW 7 131966980 missense probably damaging 1.00
R4680:Gpr26 UTSW 7 131974353 missense probably benign 0.34
R4756:Gpr26 UTSW 7 131967501 missense probably damaging 1.00
R5229:Gpr26 UTSW 7 131984247 missense probably damaging 1.00
R5610:Gpr26 UTSW 7 131966965 missense possibly damaging 0.94
R6605:Gpr26 UTSW 7 131984164 missense possibly damaging 0.91
R6653:Gpr26 UTSW 7 131984101 missense probably benign 0.00
R7213:Gpr26 UTSW 7 131967490 missense probably damaging 1.00
R7351:Gpr26 UTSW 7 131974365 missense probably damaging 1.00
R7768:Gpr26 UTSW 7 131974348 missense probably damaging 0.99
Z1088:Gpr26 UTSW 7 131984094 frame shift probably null
Z1176:Gpr26 UTSW 7 131967048 missense probably damaging 1.00
Z1176:Gpr26 UTSW 7 131967225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACACTCGCCTAGGTGATC -3'
(R):5'- TAGCTCAGCGGAAAGACCAC -3'

Sequencing Primer
(F):5'- AGACTCCGAGTGGTTCCGTG -3'
(R):5'- TGGCGGCCAGAAAGGTGTC -3'
Posted On2019-12-20