Mutagenetix > Incidental Mutation

Incidental Mutation 'R7887:Clcn3'

609121

Institutional Source

Beutler Lab

Gene Symbol

Clcn3

Ensembl Gene

ENSMUSG00000004319

Gene Name

chloride channel, voltage-sensitive 3

Synonyms

Clc3

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.378) question?

Stock #

R7887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60910389-60983300 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 60941399 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 59 (M59K)

Ref Sequence

ENSEMBL: ENSMUSP00000004430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004430] [ENSMUST00000056508] [ENSMUST00000093490] [ENSMUST00000110301] [ENSMUST00000110302]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000004430
AA Change: M59K

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000004430
Gene: ENSMUSG00000004319
AA Change: M59K

Domain	Start	End	E-Value	Type
transmembrane domain	128	150	N/A	INTRINSIC
Pfam:Voltage_CLC	220	623	1.4e-111	PFAM
CBS	667	717	2.46e-1	SMART
CBS	758	805	2.08e-8	SMART
low complexity region	847	861	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000056508
AA Change: M32K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000058648
Gene: ENSMUSG00000004319
AA Change: M32K

Domain	Start	End	E-Value	Type
transmembrane domain	101	123	N/A	INTRINSIC
Pfam:Voltage_CLC	193	596	1.4e-103	PFAM
CBS	640	690	2.46e-1	SMART
CBS	731	778	6.59e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000093490
AA Change: M1K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000091202
Gene: ENSMUSG00000004319
AA Change: M1K

Domain	Start	End	E-Value	Type
transmembrane domain	70	92	N/A	INTRINSIC
Pfam:Voltage_CLC	162	565	1.2e-103	PFAM
CBS	609	659	2.46e-1	SMART
CBS	700	747	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110301
AA Change: M59K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105930
Gene: ENSMUSG00000004319
AA Change: M59K

Domain	Start	End	E-Value	Type
transmembrane domain	128	150	N/A	INTRINSIC
Pfam:Voltage_CLC	220	623	2.7e-103	PFAM
CBS	667	717	2.46e-1	SMART
CBS	758	805	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110302
AA Change: M32K

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000105931
Gene: ENSMUSG00000004319
AA Change: M32K

Domain	Start	End	E-Value	Type
transmembrane domain	101	123	N/A	INTRINSIC
Pfam:Voltage_CLC	193	596	1.3e-103	PFAM
CBS	640	690	2.46e-1	SMART
CBS	731	778	2.08e-8	SMART
low complexity region	820	834	N/A	INTRINSIC

Meta Mutation Damage Score

0.4151

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause degeneration of hippocampal neurons and retinal photoreceptors, reduced body weight, behavioral deficits, gliosis, kyphosis and premature death, and may alter male fertility, ileum morphology, liver physiology, seizure susceptibility, and behavioral response to drugs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh8	T	A	9: 3,385,343	I580N	probably damaging	Het
Ankrd35	C	T	3: 96,684,900	T834M	probably damaging	Het
Astn2	C	T	4: 65,644,866	V893I	possibly damaging	Het
B4galt1	A	G	4: 40,823,501	Y197H	probably benign	Het
Brdt	T	C	5: 107,359,933	S676P	possibly damaging	Het
Chrdl2	T	C	7: 100,029,250	V343A	possibly damaging	Het
Cpne4	A	T	9: 105,032,791	N529I	probably damaging	Het
Crcp	G	T	5: 130,037,870	K32N	possibly damaging	Het
Ddx54	C	T	5: 120,627,203	R846C	probably damaging	Het
Dennd6a	T	C	14: 26,599,657	S118P	possibly damaging	Het
Egr3	A	G	14: 70,079,202	Y116C	probably damaging	Het
Fbxw25	A	G	9: 109,649,594		probably null	Het
Focad	T	G	4: 88,182,616	I313M	probably damaging	Het
Gm10272	C	T	10: 77,706,945	P107L	probably benign	Het
Gpr26	A	C	7: 131,966,973	I16L	probably benign	Het
Gpr39	C	A	1: 125,677,542	T69K	probably damaging	Het
Hacl1	C	T	14: 31,634,227	G97S	probably damaging	Het
Idh3b	A	C	2: 130,281,758	D136E	probably damaging	Het
Irf6	G	A	1: 193,167,732	V321M	probably damaging	Het
Klrg2	T	A	6: 38,636,571	T166S	probably damaging	Het
Lnx2	T	C	5: 147,019,043	I648V	probably damaging	Het
Mecr	A	G	4: 131,860,866		probably null	Het
Mnat1	T	A	12: 73,188,191	S205T	probably benign	Het
Mpnd	G	A	17: 56,011,097	G204D	probably benign	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Nid1	G	T	13: 13,499,733	R899L	possibly damaging	Het
Nisch	C	T	14: 31,176,695	W664*	probably null	Het
Nudt6	C	T	3: 37,412,380	V157I	possibly damaging	Het
Olfr1156	T	C	2: 87,949,880	M118V	probably damaging	Het
Olfr573-ps1	A	C	7: 102,942,151	L142R	possibly damaging	Het
Olfr949-ps1	A	T	9: 39,364,879	M107L	unknown	Het
Onecut2	T	A	18: 64,340,975	M180K	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pclo	GTCTAT	GTCTATTCTAT	5: 14,714,190		probably null	Het
Phf11d	A	G	14: 59,359,580	Y57H	probably damaging	Het
Prkaca	T	C	8: 83,986,895	V99A	probably benign	Het
Rnf144b	T	A	13: 47,239,811	C209S	probably damaging	Het
Scly	G	A	1: 91,300,641		probably null	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sphkap	T	C	1: 83,277,412	Y872C	probably benign	Het
Ssh1	C	T	5: 113,961,349		probably null	Het
Strap	T	G	6: 137,739,809	L129V	possibly damaging	Het
Sympk	T	C	7: 19,034,439	I111T	possibly damaging	Het
Tprn	C	A	2: 25,264,012	A442E	probably damaging	Het
Tsen34	T	C	7: 3,694,708	L36P	probably damaging	Het
Ubr4	T	C	4: 139,407,810	F818L	probably damaging	Het
Uggt1	T	C	1: 36,208,034	Y294C	probably damaging	Het
Usp20	A	G	2: 31,020,894	K862E	probably benign	Het
Vmn1r201	A	T	13: 22,474,786	I57F	probably damaging	Het
Wdr64	C	T	1: 175,785,545	A662V	not run	Het

Other mutations in Clcn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00782:Clcn3	APN	8	60922792	missense	probably damaging	0.99
IGL01088:Clcn3	APN	8	60937347	missense	probably damaging	1.00
IGL01449:Clcn3	APN	8	60934598	missense	probably damaging	0.97
IGL01792:Clcn3	APN	8	60929322	missense	probably damaging	1.00
IGL01845:Clcn3	APN	8	60913095	missense	probably benign	0.08
IGL01984:Clcn3	APN	8	60929580	missense	probably damaging	1.00
IGL02041:Clcn3	APN	8	60923153	missense	probably damaging	0.99
IGL02199:Clcn3	APN	8	60933092	nonsense	probably null
IGL02199:Clcn3	APN	8	60927274	missense	possibly damaging	0.82
IGL02456:Clcn3	APN	8	60941357	missense	probably damaging	1.00
IGL03353:Clcn3	APN	8	60922988	missense	probably benign	0.37
Precipice	UTSW	8	60941399	missense	probably benign	0.16
R0003:Clcn3	UTSW	8	60927296	nonsense	probably null
R0023:Clcn3	UTSW	8	60933070	splice site	probably benign
R0023:Clcn3	UTSW	8	60933070	splice site	probably benign
R0349:Clcn3	UTSW	8	60941348	missense	possibly damaging	0.91
R0437:Clcn3	UTSW	8	60934537	missense	possibly damaging	0.69
R0784:Clcn3	UTSW	8	60929203	missense	probably benign	0.25
R0840:Clcn3	UTSW	8	60929154	missense	probably benign	0.22
R1167:Clcn3	UTSW	8	60922788	critical splice donor site	probably null
R2035:Clcn3	UTSW	8	60934598	missense	probably damaging	0.97
R2193:Clcn3	UTSW	8	60929187	missense	possibly damaging	0.56
R3697:Clcn3	UTSW	8	60913123	missense	probably benign	0.02
R3736:Clcn3	UTSW	8	60983652	unclassified	probably benign
R4676:Clcn3	UTSW	8	60930651	intron	probably benign
R4807:Clcn3	UTSW	8	60934530	missense	probably damaging	1.00
R5112:Clcn3	UTSW	8	60954552	missense	probably benign	0.07
R5200:Clcn3	UTSW	8	60923005	missense	probably damaging	0.99
R5652:Clcn3	UTSW	8	60919353	missense	possibly damaging	0.81
R5712:Clcn3	UTSW	8	60937298	critical splice donor site	probably null
R5731:Clcn3	UTSW	8	60922889	missense	possibly damaging	0.46
R5814:Clcn3	UTSW	8	60934573	missense	probably damaging	1.00
R6134:Clcn3	UTSW	8	60934573	missense	probably damaging	1.00
R6370:Clcn3	UTSW	8	60923024	missense	probably damaging	1.00
R6371:Clcn3	UTSW	8	60937335	missense	probably benign	0.06
R6394:Clcn3	UTSW	8	60941291	missense	probably damaging	0.99
R6466:Clcn3	UTSW	8	60929561	missense	probably damaging	1.00
R6588:Clcn3	UTSW	8	60914827	missense	probably benign	0.03
R6750:Clcn3	UTSW	8	60914775	missense	possibly damaging	0.93
R7522:Clcn3	UTSW	8	60941412	missense	probably benign
R7556:Clcn3	UTSW	8	60929487	missense	probably damaging	0.99
R7557:Clcn3	UTSW	8	60937368	missense	probably damaging	0.99
R7685:Clcn3	UTSW	8	60933085	missense	possibly damaging	0.54
R8219:Clcn3	UTSW	8	60922966	missense	probably damaging	0.98
R8478:Clcn3	UTSW	8	60919488	missense	probably benign
R8825:Clcn3	UTSW	8	60929488	missense	probably damaging	0.99
R9132:Clcn3	UTSW	8	60929102	missense	probably damaging	0.99
R9313:Clcn3	UTSW	8	60937469	missense	probably damaging	0.99
R9473:Clcn3	UTSW	8	60954617	missense	probably benign	0.01
R9475:Clcn3	UTSW	8	60934517	missense	probably damaging	0.96
R9598:Clcn3	UTSW	8	60913027	missense	unknown
R9697:Clcn3	UTSW	8	60919484	missense	probably damaging	1.00
R9718:Clcn3	UTSW	8	60937400	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CCTGCAATCAGTGGCAGAAATAC -3'
(R):5'- CTAATAGAACTGTGTGAGGTCATGAG -3'

Sequencing Primer
(F):5'- TTGTAAACGATCCATCTTGCAC -3'
(R):5'- TGAGGTCATGAGTATTATTTTTGCC -3'

Posted On

2019-12-20