Incidental Mutation 'R7887:Prkaca'
ID609122
Institutional Source Beutler Lab
Gene Symbol Prkaca
Ensembl Gene ENSMUSG00000005469
Gene Nameprotein kinase, cAMP dependent, catalytic, alpha
SynonymsPkaca, C alpha, PKA, Cs
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.544) question?
Stock #R7887 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location83972993-83996443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83986895 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 99 (V99A)
Ref Sequence ENSEMBL: ENSMUSP00000005606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005606] [ENSMUST00000211558]
PDB Structure
2.0 ANGSTROM REFINED CRYSTAL STRUCTURE OF THE CATALYTIC SUBUNIT OF CAMP-DEPENDENT PROTEIN KINASE COMPLEXED WITH A PEPTIDE INHIBITOR AND DETERGENT [X-RAY DIFFRACTION]
2.2 angstrom refined crystal structure of the catalytic subunit of cAMP-dependent protein kinase complexed with MNATP and a peptide inhibitor [X-RAY DIFFRACTION]
A BINARY COMPLEX OF THE CATALYTIC SUBUNIT OF CAMP-DEPENDENT PROTEIN KINASE AND ADENOSINE FURTHER DEFINES CONFORMATIONAL FLEXIBILITY [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE POTENT NATURAL PRODUCT INHIBITOR BALANOL IN COMPLEX WITH THE CATALYTIC SUBUNIT OF CAMP-DEPENDENT PROTEIN KINASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF A POLYHISTIDINE-TAGGED RECOMBINANT CATALYTIC SUBUNIT OF CAMP-DEPENDENT PROTEIN KINASE COMPLEXED WITH THE PEPTIDE INHIBITOR PKI(5-24) AND ADENOSINE [X-RAY DIFFRACTION]
Crystal structure of apoenzyme cAMP-dependent protein kinase catalytic subunit [X-RAY DIFFRACTION]
Crystal Structure of the Catalytic Subunit of cAMP-dependent Protein Kinase Complexed with a Substrate Peptide, ADP and Detergent [X-RAY DIFFRACTION]
Crystal Structure of the Catalytic Subunit of cAMP-dependent Protein Kinase Complexed with a Phosphorylated Substrate Peptide and Detergent [X-RAY DIFFRACTION]
Crystal Structure of a Transition State Mimic of the Catalytic Subunit of cAMP-dependent Protein Kinase [X-RAY DIFFRACTION]
[]
>> 51 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000005606
AA Change: V99A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000005606
Gene: ENSMUSG00000005469
AA Change: V99A

DomainStartEndE-ValueType
S_TKc 44 298 2e-107 SMART
S_TK_X 299 344 3.7e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211558
AA Change: V91A

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.5557 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a member of the serine/threonine protein kinase family. The holoenzyme, protein kinase A (also known as cyclic-AMP dependent protein kinase), mediates cellular response to changes in cyclic-AMP levels. This gene encodes the alpha catalytic subunit of protein kinase A. Protein kinase A-mediated signaling is transduced via phosphorylation of target proteins, and is important for many cellular functions, including mammalian sperm maturation and motility. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mutant mice are highly susceptible to perinatal lethality. Surviving mice are runted and while spermatogenesis progresses normally, mature sperm shows impaired motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Prkaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Prkaca APN 8 83990737 missense probably damaging 1.00
IGL02011:Prkaca APN 8 83990936 missense probably damaging 1.00
IGL03022:Prkaca APN 8 83995347 missense possibly damaging 0.56
IGL03038:Prkaca APN 8 83994951 missense probably benign
IGL03236:Prkaca APN 8 83990445 missense probably damaging 1.00
R0013:Prkaca UTSW 8 83988303 missense possibly damaging 0.64
R0458:Prkaca UTSW 8 83995282 splice site probably benign
R1693:Prkaca UTSW 8 83981198 missense probably benign
R1827:Prkaca UTSW 8 83990987 critical splice donor site probably null
R1860:Prkaca UTSW 8 83981223 missense probably benign 0.11
R1955:Prkaca UTSW 8 83988317 missense probably damaging 0.97
R4084:Prkaca UTSW 8 83995310 missense probably damaging 1.00
R4770:Prkaca UTSW 8 83990870 missense probably benign 0.05
R7867:Prkaca UTSW 8 83995334 missense probably benign 0.00
R8313:Prkaca UTSW 8 83990522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTGATCTGTGTGGACC -3'
(R):5'- GCTGACTGAAGAGCTTAAGCAG -3'

Sequencing Primer
(F):5'- TGATCTGTGTGGACCCTCGAC -3'
(R):5'- AGCTTAAGCAGAGGGCCC -3'
Posted On2019-12-20