Incidental Mutation 'R7887:Alkbh8'
ID609123
Institutional Source Beutler Lab
Gene Symbol Alkbh8
Ensembl Gene ENSMUSG00000025899
Gene NamealkB homolog 8, tRNA methyltransferase
Synonyms4930562C03Rik, Abh8, 9430088N01Rik, 8030431D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7887 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location3335140-3391154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3385343 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 580 (I580N)
Ref Sequence ENSEMBL: ENSMUSP00000061511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053407] [ENSMUST00000165105] [ENSMUST00000211933] [ENSMUST00000212294] [ENSMUST00000212358]
Predicted Effect probably damaging
Transcript: ENSMUST00000053407
AA Change: I580N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061511
Gene: ENSMUSG00000025899
AA Change: I580N

DomainStartEndE-ValueType
Pfam:DUF1891 1 37 4.9e-18 PFAM
RRM 44 116 1.64e-2 SMART
Pfam:2OG-FeII_Oxy_2 136 334 8.7e-27 PFAM
Pfam:2OG-FeII_Oxy 220 336 1.8e-11 PFAM
Pfam:Methyltransf_8 359 522 4.5e-8 PFAM
Pfam:Methyltransf_23 386 534 1e-9 PFAM
Pfam:Methyltransf_31 404 547 3.5e-8 PFAM
Pfam:Methyltransf_25 410 497 1.7e-9 PFAM
Pfam:Methyltransf_11 411 501 5.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165105
AA Change: I580N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125996
Gene: ENSMUSG00000025899
AA Change: I580N

DomainStartEndE-ValueType
Pfam:DUF1891 1 37 4.9e-18 PFAM
RRM 44 116 1.64e-2 SMART
Pfam:2OG-FeII_Oxy_2 136 334 1.6e-24 PFAM
Pfam:Methyltransf_8 359 522 4.5e-8 PFAM
Pfam:Methyltransf_25 410 497 1.5e-9 PFAM
Pfam:Methyltransf_11 411 501 1.8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211933
AA Change: I580N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000212294
AA Change: I545N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000212358
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Homozygous mutants show no obvious phenotype at 20 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Alkbh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Alkbh8 APN 9 3359588 missense probably damaging 1.00
IGL01419:Alkbh8 APN 9 3385354 missense probably damaging 1.00
IGL01457:Alkbh8 APN 9 3369825 missense probably damaging 1.00
IGL02398:Alkbh8 APN 9 3345870 missense possibly damaging 0.77
IGL02503:Alkbh8 APN 9 3347852 missense probably damaging 1.00
IGL02824:Alkbh8 APN 9 3368021 splice site probably null
IGL03001:Alkbh8 APN 9 3344602 missense probably benign
IGL03055:Alkbh8 APN 9 3345882 splice site probably benign
R0046:Alkbh8 UTSW 9 3343247 missense probably damaging 1.00
R0046:Alkbh8 UTSW 9 3343247 missense probably damaging 1.00
R0403:Alkbh8 UTSW 9 3385469 missense probably damaging 1.00
R1331:Alkbh8 UTSW 9 3347916 splice site probably null
R1688:Alkbh8 UTSW 9 3382765 missense probably damaging 1.00
R1859:Alkbh8 UTSW 9 3385499 missense probably benign 0.07
R2014:Alkbh8 UTSW 9 3343216 nonsense probably null
R3016:Alkbh8 UTSW 9 3369658 missense probably benign 0.08
R3722:Alkbh8 UTSW 9 3385153 missense probably damaging 1.00
R4744:Alkbh8 UTSW 9 3344604 nonsense probably null
R4840:Alkbh8 UTSW 9 3369751 missense probably damaging 1.00
R5403:Alkbh8 UTSW 9 3385318 missense probably benign 0.00
R5644:Alkbh8 UTSW 9 3385384 missense probably damaging 1.00
R5677:Alkbh8 UTSW 9 3385147 missense possibly damaging 0.93
R5902:Alkbh8 UTSW 9 3385414 missense probably benign 0.04
R6293:Alkbh8 UTSW 9 3347841 missense possibly damaging 0.52
R7352:Alkbh8 UTSW 9 3345796 missense probably damaging 0.99
R7457:Alkbh8 UTSW 9 3343056 missense probably damaging 0.99
R7869:Alkbh8 UTSW 9 3359503 missense probably damaging 1.00
R8052:Alkbh8 UTSW 9 3385478 missense probably damaging 1.00
R8506:Alkbh8 UTSW 9 3335616 unclassified probably benign
X0028:Alkbh8 UTSW 9 3369767 missense probably benign 0.01
X0062:Alkbh8 UTSW 9 3359532 missense probably null 1.00
Z1176:Alkbh8 UTSW 9 3345820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCATTTATGTCTGGGCAATG -3'
(R):5'- AGCTTCCAATTCTCCATCACAG -3'

Sequencing Primer
(F):5'- ATCAGAAGTCCAAGTATCTTAGAGG -3'
(R):5'- ATTCTCCATCACAGAAAACATGG -3'
Posted On2019-12-20