Incidental Mutation 'R7887:Cpne4'
ID609125
Institutional Source Beutler Lab
Gene Symbol Cpne4
Ensembl Gene ENSMUSG00000032564
Gene Namecopine IV
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7887 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location104547286-105034544 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105032791 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 529 (N529I)
Ref Sequence ENSEMBL: ENSMUSP00000049663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057742] [ENSMUST00000077190]
Predicted Effect probably damaging
Transcript: ENSMUST00000057742
AA Change: N529I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049663
Gene: ENSMUSG00000032564
AA Change: N529I

DomainStartEndE-ValueType
C2 24 130 4.29e-6 SMART
C2 144 261 4.22e-5 SMART
low complexity region 269 279 N/A INTRINSIC
VWA 305 507 2.61e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000077190
AA Change: N447I
SMART Domains Protein: ENSMUSP00000076432
Gene: ENSMUSG00000032564
AA Change: N447I

DomainStartEndE-ValueType
C2 24 130 4.29e-6 SMART
C2 144 275 1.94e1 SMART
VWA 223 425 9.73e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the highly conserved copine family. It encodes a calcium-dependent, phospholipid-binding protein, which may be involved in membrane trafficking, mitogenesis and development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Cpne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Cpne4 APN 9 104901511 missense probably damaging 1.00
IGL01871:Cpne4 APN 9 104925757 missense possibly damaging 0.93
IGL02097:Cpne4 APN 9 104686502 missense probably damaging 1.00
IGL02698:Cpne4 APN 9 105032785 missense probably damaging 1.00
IGL02933:Cpne4 APN 9 105019767 missense possibly damaging 0.64
R0471:Cpne4 UTSW 9 105022282 splice site probably null
R0528:Cpne4 UTSW 9 104686441 missense probably damaging 0.99
R0698:Cpne4 UTSW 9 104925795 missense probably damaging 1.00
R1025:Cpne4 UTSW 9 104993858 missense possibly damaging 0.64
R1054:Cpne4 UTSW 9 105022401 missense probably benign 0.01
R1300:Cpne4 UTSW 9 104993134 missense probably damaging 1.00
R1422:Cpne4 UTSW 9 104900285 missense probably damaging 0.98
R1439:Cpne4 UTSW 9 104989632 missense probably damaging 0.99
R1634:Cpne4 UTSW 9 104989579 missense possibly damaging 0.94
R1777:Cpne4 UTSW 9 104872688 missense probably damaging 1.00
R2992:Cpne4 UTSW 9 105022365 missense probably damaging 1.00
R4094:Cpne4 UTSW 9 104686535 missense probably damaging 1.00
R4729:Cpne4 UTSW 9 104922556 missense probably damaging 0.96
R4943:Cpne4 UTSW 9 105019773 missense probably damaging 1.00
R5119:Cpne4 UTSW 9 104901521 splice site probably null
R5787:Cpne4 UTSW 9 105022401 missense probably benign 0.01
R5839:Cpne4 UTSW 9 104925828 missense probably damaging 1.00
R5876:Cpne4 UTSW 9 104925770 missense probably damaging 0.98
R7386:Cpne4 UTSW 9 104872740 missense possibly damaging 0.82
R7849:Cpne4 UTSW 9 104686519 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAGCGTGAACACTGAGTG -3'
(R):5'- AGGGTTTAACAGATCCAGGC -3'

Sequencing Primer
(F):5'- AACACTGAGTGGGTGATAGTTG -3'
(R):5'- GCCTTGGGCTACACATGC -3'
Posted On2019-12-20