Incidental Mutation 'R7887:Mnat1'
ID 609128
Institutional Source Beutler Lab
Gene Symbol Mnat1
Ensembl Gene ENSMUSG00000021103
Gene Name menage a trois 1
Synonyms E130115E11Rik, MAT1
MMRRC Submission 045939-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7887 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 73170491-73320762 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 73234965 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 205 (S205T)
Ref Sequence ENSEMBL: ENSMUSP00000021523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021523] [ENSMUST00000187549] [ENSMUST00000189644]
AlphaFold P51949
Predicted Effect probably benign
Transcript: ENSMUST00000021523
AA Change: S205T

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021523
Gene: ENSMUSG00000021103
AA Change: S205T

DomainStartEndE-ValueType
RING 6 49 3.24e-4 SMART
Pfam:MAT1 53 250 2.1e-67 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000187549
AA Change: S205T

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141036
Gene: ENSMUSG00000021103
AA Change: S205T

DomainStartEndE-ValueType
RING 6 49 1.6e-6 SMART
Pfam:MAT1 53 238 1.7e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189644
SMART Domains Protein: ENSMUSP00000141146
Gene: ENSMUSG00000021103

DomainStartEndE-ValueType
RING 6 49 1.6e-6 SMART
Pfam:MAT1 53 90 4.2e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, along with cyclin H and CDK7, forms the CDK-activating kinase (CAK) enzymatic complex. This complex activates several cyclin-associated kinases and can also associate with TFIIH to activate transcription by RNA polymerase II. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruption of this gene die as embryos at some point between implantation and gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 (GRCm39) I580N probably damaging Het
Ankrd35 C T 3: 96,592,216 (GRCm39) T834M probably damaging Het
Astn2 C T 4: 65,563,103 (GRCm39) V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 (GRCm39) Y197H probably benign Het
Brdt T C 5: 107,507,799 (GRCm39) S676P possibly damaging Het
Chrdl2 T C 7: 99,678,457 (GRCm39) V343A possibly damaging Het
Clcn3 A T 8: 61,394,433 (GRCm39) M59K probably benign Het
Cpne4 A T 9: 104,909,990 (GRCm39) N529I probably damaging Het
Crcp G T 5: 130,066,711 (GRCm39) K32N possibly damaging Het
Ddx54 C T 5: 120,765,268 (GRCm39) R846C probably damaging Het
Dennd6a T C 14: 26,320,812 (GRCm39) S118P possibly damaging Het
Egr3 A G 14: 70,316,651 (GRCm39) Y116C probably damaging Het
Fbxw25 A G 9: 109,478,662 (GRCm39) probably null Het
Focad T G 4: 88,100,853 (GRCm39) I313M probably damaging Het
Gm10272 C T 10: 77,542,779 (GRCm39) P107L probably benign Het
Gpr26 A C 7: 131,568,702 (GRCm39) I16L probably benign Het
Gpr39 C A 1: 125,605,279 (GRCm39) T69K probably damaging Het
Hacl1 C T 14: 31,356,184 (GRCm39) G97S probably damaging Het
Idh3b A C 2: 130,123,678 (GRCm39) D136E probably damaging Het
Irf6 G A 1: 192,850,040 (GRCm39) V321M probably damaging Het
Klrg2 T A 6: 38,613,506 (GRCm39) T166S probably damaging Het
Lnx2 T C 5: 146,955,853 (GRCm39) I648V probably damaging Het
Mecr A G 4: 131,588,177 (GRCm39) probably null Het
Mpnd G A 17: 56,318,097 (GRCm39) G204D probably benign Het
Myh7 C T 14: 55,221,119 (GRCm39) E935K possibly damaging Het
Nid1 G T 13: 13,674,318 (GRCm39) R899L possibly damaging Het
Nisch C T 14: 30,898,652 (GRCm39) W664* probably null Het
Nudt6 C T 3: 37,466,529 (GRCm39) V157I possibly damaging Het
Onecut2 T A 18: 64,474,046 (GRCm39) M180K possibly damaging Het
Or51h7 A C 7: 102,591,358 (GRCm39) L142R possibly damaging Het
Or5l13 T C 2: 87,780,224 (GRCm39) M118V probably damaging Het
Or8g31-ps1 A T 9: 39,276,175 (GRCm39) M107L unknown Het
Parg T A 14: 31,939,619 (GRCm39) D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,764,204 (GRCm39) probably null Het
Phf11d A G 14: 59,597,029 (GRCm39) Y57H probably damaging Het
Prkaca T C 8: 84,713,524 (GRCm39) V99A probably benign Het
Rnf144b T A 13: 47,393,287 (GRCm39) C209S probably damaging Het
Scly G A 1: 91,228,363 (GRCm39) probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Sphkap T C 1: 83,255,133 (GRCm39) Y872C probably benign Het
Ssh1 C T 5: 114,099,410 (GRCm39) probably null Het
Strap T G 6: 137,716,807 (GRCm39) L129V possibly damaging Het
Sympk T C 7: 18,768,364 (GRCm39) I111T possibly damaging Het
Tprn C A 2: 25,154,024 (GRCm39) A442E probably damaging Het
Tsen34 T C 7: 3,697,707 (GRCm39) L36P probably damaging Het
Ubr4 T C 4: 139,135,121 (GRCm39) F818L probably damaging Het
Uggt1 T C 1: 36,247,115 (GRCm39) Y294C probably damaging Het
Usp20 A G 2: 30,910,906 (GRCm39) K862E probably benign Het
Vmn1r201 A T 13: 22,658,956 (GRCm39) I57F probably damaging Het
Wdr64 C T 1: 175,613,111 (GRCm39) A662V not run Het
Other mutations in Mnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01907:Mnat1 APN 12 73,319,213 (GRCm39) missense probably benign 0.01
IGL01959:Mnat1 APN 12 73,228,705 (GRCm39) splice site probably benign
IGL02491:Mnat1 APN 12 73,170,682 (GRCm39) missense probably null 0.83
IGL02876:Mnat1 APN 12 73,217,378 (GRCm39) missense probably damaging 0.98
R0312:Mnat1 UTSW 12 73,228,558 (GRCm39) missense possibly damaging 0.92
R0488:Mnat1 UTSW 12 73,217,413 (GRCm39) missense probably damaging 1.00
R0709:Mnat1 UTSW 12 73,234,962 (GRCm39) missense possibly damaging 0.92
R0846:Mnat1 UTSW 12 73,170,706 (GRCm39) splice site probably null
R1080:Mnat1 UTSW 12 73,319,292 (GRCm39) missense probably damaging 0.98
R1803:Mnat1 UTSW 12 73,226,007 (GRCm39) nonsense probably null
R2338:Mnat1 UTSW 12 73,265,917 (GRCm39) critical splice donor site probably null
R2516:Mnat1 UTSW 12 73,228,550 (GRCm39) splice site probably benign
R4414:Mnat1 UTSW 12 73,228,601 (GRCm39) missense probably damaging 0.99
R4957:Mnat1 UTSW 12 73,170,652 (GRCm39) missense probably damaging 1.00
R6323:Mnat1 UTSW 12 73,214,878 (GRCm39) missense probably damaging 1.00
R6738:Mnat1 UTSW 12 73,319,246 (GRCm39) missense probably benign 0.00
R6769:Mnat1 UTSW 12 73,319,196 (GRCm39) missense probably benign 0.00
R7002:Mnat1 UTSW 12 73,277,479 (GRCm39) intron probably benign
R7182:Mnat1 UTSW 12 73,277,452 (GRCm39) nonsense probably null
R8118:Mnat1 UTSW 12 73,265,864 (GRCm39) missense probably benign
R9311:Mnat1 UTSW 12 73,214,916 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGCTAGATGAAATAGGACCCTAC -3'
(R):5'- TGAGAAGTACTGCTTTCCACTCTC -3'

Sequencing Primer
(F):5'- AGGACCCTACTATAGTCTCTTTAATG -3'
(R):5'- TCTATATTTCCAGACATCTAACCCAG -3'
Posted On 2019-12-20