Mutagenetix > Incidental Mutation

Incidental Mutation 'R7887:Nid1'

609129

Institutional Source

Beutler Lab

Gene Symbol

Nid1

Ensembl Gene

ENSMUSG00000005397

Gene Name

nidogen 1

Synonyms

entactin 1, nidogen-1, entactin, entactin-1

MMRRC Submission

045939-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R7887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13437551-13512269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 13499733 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 899 (R899L)

Ref Sequence

ENSEMBL: ENSMUSP00000005532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005532]

AlphaFold

P10493

PDB Structure

NIDOGEN-1 G2/PERLECAN IG3 COMPLEX [X-RAY DIFFRACTION]
DOMAIN G2 OF MOUSE NIDOGEN-1 [X-RAY DIFFRACTION]
Crystal structure of Nidogen/Laminin Complex [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005532
AA Change: R899L

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000005532
Gene: ENSMUSG00000005397
AA Change: R899L

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
NIDO	106	270	3.8e-70	SMART
low complexity region	277	296	N/A	INTRINSIC
EGF	387	424	3.46e0	SMART
G2F	425	664	7.69e-153	SMART
EGF	669	707	8.65e-1	SMART
EGF_CA	708	749	4.38e-11	SMART
EGF	759	799	8.19e-2	SMART
EGF_CA	800	838	1.42e-10	SMART
TY	873	921	1.17e-19	SMART
LY	968	1010	1.35e-2	SMART
LY	1011	1053	4.34e-15	SMART
LY	1054	1098	3.34e-16	SMART
LY	1099	1141	3.25e-5	SMART
LY	1142	1181	1.08e1	SMART
EGF	1209	1242	2.45e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane glycoproteins. The protein interacts with several other components of basement membranes, and may play a role in cell interactions with the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurologic deficits including seizure-like symptoms and loss of muscle control in the hind legs, and show altered basement membrane morphology in selected locations including brain capillaries and the lens capsule. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh8	T	A	9: 3,385,343	I580N	probably damaging	Het
Ankrd35	C	T	3: 96,684,900	T834M	probably damaging	Het
Astn2	C	T	4: 65,644,866	V893I	possibly damaging	Het
B4galt1	A	G	4: 40,823,501	Y197H	probably benign	Het
Brdt	T	C	5: 107,359,933	S676P	possibly damaging	Het
Chrdl2	T	C	7: 100,029,250	V343A	possibly damaging	Het
Clcn3	A	T	8: 60,941,399	M59K	probably benign	Het
Cpne4	A	T	9: 105,032,791	N529I	probably damaging	Het
Crcp	G	T	5: 130,037,870	K32N	possibly damaging	Het
Ddx54	C	T	5: 120,627,203	R846C	probably damaging	Het
Dennd6a	T	C	14: 26,599,657	S118P	possibly damaging	Het
Egr3	A	G	14: 70,079,202	Y116C	probably damaging	Het
Fbxw25	A	G	9: 109,649,594		probably null	Het
Focad	T	G	4: 88,182,616	I313M	probably damaging	Het
Gm10272	C	T	10: 77,706,945	P107L	probably benign	Het
Gpr26	A	C	7: 131,966,973	I16L	probably benign	Het
Gpr39	C	A	1: 125,677,542	T69K	probably damaging	Het
Hacl1	C	T	14: 31,634,227	G97S	probably damaging	Het
Idh3b	A	C	2: 130,281,758	D136E	probably damaging	Het
Irf6	G	A	1: 193,167,732	V321M	probably damaging	Het
Klrg2	T	A	6: 38,636,571	T166S	probably damaging	Het
Lnx2	T	C	5: 147,019,043	I648V	probably damaging	Het
Mecr	A	G	4: 131,860,866		probably null	Het
Mnat1	T	A	12: 73,188,191	S205T	probably benign	Het
Mpnd	G	A	17: 56,011,097	G204D	probably benign	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Nisch	C	T	14: 31,176,695	W664*	probably null	Het
Nudt6	C	T	3: 37,412,380	V157I	possibly damaging	Het
Olfr1156	T	C	2: 87,949,880	M118V	probably damaging	Het
Olfr573-ps1	A	C	7: 102,942,151	L142R	possibly damaging	Het
Olfr949-ps1	A	T	9: 39,364,879	M107L	unknown	Het
Onecut2	T	A	18: 64,340,975	M180K	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pclo	GTCTAT	GTCTATTCTAT	5: 14,714,190		probably null	Het
Phf11d	A	G	14: 59,359,580	Y57H	probably damaging	Het
Prkaca	T	C	8: 83,986,895	V99A	probably benign	Het
Rnf144b	T	A	13: 47,239,811	C209S	probably damaging	Het
Scly	G	A	1: 91,300,641		probably null	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sphkap	T	C	1: 83,277,412	Y872C	probably benign	Het
Ssh1	C	T	5: 113,961,349		probably null	Het
Strap	T	G	6: 137,739,809	L129V	possibly damaging	Het
Sympk	T	C	7: 19,034,439	I111T	possibly damaging	Het
Tprn	C	A	2: 25,264,012	A442E	probably damaging	Het
Tsen34	T	C	7: 3,694,708	L36P	probably damaging	Het
Ubr4	T	C	4: 139,407,810	F818L	probably damaging	Het
Uggt1	T	C	1: 36,208,034	Y294C	probably damaging	Het
Usp20	A	G	2: 31,020,894	K862E	probably benign	Het
Vmn1r201	A	T	13: 22,474,786	I57F	probably damaging	Het
Wdr64	C	T	1: 175,785,545	A662V	not run	Het

Other mutations in Nid1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Nid1	APN	13	13476392	missense	probably damaging	1.00
IGL02126:Nid1	APN	13	13489158	splice site	probably null
IGL02452:Nid1	APN	13	13508720	missense	probably benign	0.17
IGL02806:Nid1	APN	13	13468312	missense	probably benign	0.00
IGL02966:Nid1	APN	13	13482221	missense	probably benign	0.09
IGL03136:Nid1	APN	13	13500499	missense	probably benign	0.33
IGL03411:Nid1	APN	13	13437889	missense	probably damaging	0.98
R0384:Nid1	UTSW	13	13463836	missense	probably benign	0.34
R0413:Nid1	UTSW	13	13482096	missense	probably benign	0.01
R1257:Nid1	UTSW	13	13483790	missense	probably benign	0.01
R1390:Nid1	UTSW	13	13476246	missense	probably damaging	1.00
R1397:Nid1	UTSW	13	13508795	missense	possibly damaging	0.94
R2057:Nid1	UTSW	13	13500473	missense	probably benign	0.00
R2058:Nid1	UTSW	13	13500473	missense	probably benign	0.00
R2059:Nid1	UTSW	13	13500473	missense	probably benign	0.00
R2132:Nid1	UTSW	13	13509486	missense	probably benign	0.04
R2140:Nid1	UTSW	13	13499668	missense	probably damaging	1.00
R2195:Nid1	UTSW	13	13476203	missense	probably damaging	1.00
R2237:Nid1	UTSW	13	13500485	missense	probably benign
R2312:Nid1	UTSW	13	13500493	missense	probably benign	0.15
R2987:Nid1	UTSW	13	13499673	missense	probably benign	0.40
R3696:Nid1	UTSW	13	13486759	missense	probably damaging	0.99
R3697:Nid1	UTSW	13	13486759	missense	probably damaging	0.99
R3698:Nid1	UTSW	13	13486759	missense	probably damaging	0.99
R3772:Nid1	UTSW	13	13476418	splice site	probably benign
R4092:Nid1	UTSW	13	13486639	missense	probably damaging	0.96
R4126:Nid1	UTSW	13	13476372	missense	probably damaging	1.00
R4128:Nid1	UTSW	13	13476372	missense	probably damaging	1.00
R4680:Nid1	UTSW	13	13472852	missense	probably damaging	1.00
R4717:Nid1	UTSW	13	13506501	missense	probably benign	0.00
R4783:Nid1	UTSW	13	13499741	missense	probably damaging	0.97
R4812:Nid1	UTSW	13	13506468	nonsense	probably null
R4834:Nid1	UTSW	13	13508823	missense	probably damaging	1.00
R4915:Nid1	UTSW	13	13499586	missense	possibly damaging	0.89
R4930:Nid1	UTSW	13	13510011	missense	probably damaging	1.00
R5101:Nid1	UTSW	13	13483754	missense	probably damaging	1.00
R5276:Nid1	UTSW	13	13468572	missense	probably damaging	0.99
R5427:Nid1	UTSW	13	13483683	missense	probably damaging	1.00
R5447:Nid1	UTSW	13	13437910	missense	probably benign	0.00
R5507:Nid1	UTSW	13	13489037	nonsense	probably null
R5663:Nid1	UTSW	13	13472834	missense	probably damaging	1.00
R5868:Nid1	UTSW	13	13489157	critical splice donor site	probably null
R6313:Nid1	UTSW	13	13463782	missense	probably benign	0.01
R6761:Nid1	UTSW	13	13482035	missense	probably benign	0.22
R7069:Nid1	UTSW	13	13508768	missense	probably benign
R7208:Nid1	UTSW	13	13468385	missense	probably benign	0.01
R7284:Nid1	UTSW	13	13489090	missense	probably benign	0.01
R7434:Nid1	UTSW	13	13468464	missense	probably benign
R7449:Nid1	UTSW	13	13482051	missense	probably damaging	1.00
R7574:Nid1	UTSW	13	13468443	missense	probably benign
R7762:Nid1	UTSW	13	13489045	missense	probably damaging	1.00
R8420:Nid1	UTSW	13	13437831	missense	possibly damaging	0.81
R8506:Nid1	UTSW	13	13476174	missense	probably damaging	0.99
R8756:Nid1	UTSW	13	13508801	missense	probably benign	0.32
R8903:Nid1	UTSW	13	13463930	missense	probably benign	0.00
R9084:Nid1	UTSW	13	13478340	critical splice donor site	probably null
R9297:Nid1	UTSW	13	13476312	missense	possibly damaging	0.92
R9344:Nid1	UTSW	13	13478309	missense	probably damaging	1.00
R9552:Nid1	UTSW	13	13502460	missense	probably damaging	0.99
X0028:Nid1	UTSW	13	13509534	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CAAGTAGCATTTGGGAACACC -3'
(R):5'- GGCATCCTCAGACCTCATAAGC -3'

Sequencing Primer
(F):5'- TGGCACAAATGACACTCTGCTTG -3'
(R):5'- GCAGAAACATGACCACCTGGG -3'

Posted On

2019-12-20