Incidental Mutation 'R7887:Vmn1r201'
ID609130
Institutional Source Beutler Lab
Gene Symbol Vmn1r201
Ensembl Gene ENSMUSG00000094898
Gene Namevomeronasal 1 receptor 201
SynonymsV1ri4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R7887 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location22471923-22478701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22474786 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 57 (I57F)
Ref Sequence ENSEMBL: ENSMUSP00000089324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091730] [ENSMUST00000226330] [ENSMUST00000226965]
Predicted Effect probably damaging
Transcript: ENSMUST00000091730
AA Change: I57F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089324
Gene: ENSMUSG00000094898
AA Change: I57F

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 2.4e-9 PFAM
Pfam:V1R 35 299 1.1e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226330
AA Change: I57F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000226965
AA Change: I57F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Vmn1r201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02792:Vmn1r201 APN 13 22474844 missense probably damaging 0.97
IGL03137:Vmn1r201 APN 13 22474804 missense probably benign 0.01
R0278:Vmn1r201 UTSW 13 22475024 missense probably damaging 1.00
R0381:Vmn1r201 UTSW 13 22475023 missense probably damaging 1.00
R0544:Vmn1r201 UTSW 13 22475146 missense probably benign 0.04
R1411:Vmn1r201 UTSW 13 22474679 missense probably benign 0.01
R1544:Vmn1r201 UTSW 13 22474798 missense probably benign 0.20
R1850:Vmn1r201 UTSW 13 22474631 missense probably benign 0.08
R1891:Vmn1r201 UTSW 13 22475255 missense probably benign 0.01
R2071:Vmn1r201 UTSW 13 22474825 missense probably benign 0.34
R4183:Vmn1r201 UTSW 13 22474852 missense probably benign 0.01
R4924:Vmn1r201 UTSW 13 22474712 missense probably benign 0.00
R4989:Vmn1r201 UTSW 13 22475452 missense possibly damaging 0.95
R5028:Vmn1r201 UTSW 13 22475360 nonsense probably null
R5318:Vmn1r201 UTSW 13 22474922 missense probably damaging 1.00
R5369:Vmn1r201 UTSW 13 22475502 missense probably benign 0.00
R5682:Vmn1r201 UTSW 13 22475185 missense probably damaging 0.99
R5699:Vmn1r201 UTSW 13 22475239 missense probably damaging 1.00
R6180:Vmn1r201 UTSW 13 22475329 missense possibly damaging 0.94
R6273:Vmn1r201 UTSW 13 22475215 missense probably damaging 1.00
R6295:Vmn1r201 UTSW 13 22475363 missense probably benign 0.00
R6331:Vmn1r201 UTSW 13 22475351 missense probably damaging 1.00
R7296:Vmn1r201 UTSW 13 22475339 missense possibly damaging 0.69
R7758:Vmn1r201 UTSW 13 22474819 missense not run
R7832:Vmn1r201 UTSW 13 22475368 missense possibly damaging 0.76
R7915:Vmn1r201 UTSW 13 22475368 missense possibly damaging 0.76
R7970:Vmn1r201 UTSW 13 22474786 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTTTGTTTCGATCAGAATAGCAG -3'
(R):5'- CCAAATGGTTGTCCTGGGAC -3'

Sequencing Primer
(F):5'- ATAGCAGAGAAAGTTGTGTGTGATTC -3'
(R):5'- CAAATGGTTGTCCTGGGACTGATG -3'
Posted On2019-12-20