Incidental Mutation 'R7887:Rnf144b'
ID 609131
Institutional Source Beutler Lab
Gene Symbol Rnf144b
Ensembl Gene ENSMUSG00000038068
Gene Name ring finger protein 144B
Synonyms Ibrdc2, E130105P19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7887 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 47122656-47247991 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 47239811 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 209 (C209S)
Ref Sequence ENSEMBL: ENSMUSP00000071017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068891] [ENSMUST00000110111]
AlphaFold Q8BKD6
Predicted Effect probably damaging
Transcript: ENSMUST00000068891
AA Change: C209S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071017
Gene: ENSMUSG00000038068
AA Change: C209S

DomainStartEndE-ValueType
RING 30 78 2.24e0 SMART
IBR 101 166 2.16e-16 SMART
IBR 172 238 1.3e0 SMART
RING 191 283 6.17e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110111
AA Change: C209S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105738
Gene: ENSMUSG00000038068
AA Change: C209S

DomainStartEndE-ValueType
RING 30 78 2.24e0 SMART
IBR 101 166 2.16e-16 SMART
IBR 172 238 1.3e0 SMART
RING 191 283 6.17e-2 SMART
Meta Mutation Damage Score 0.9741 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Rnf144b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Rnf144b APN 13 47220488 splice site probably benign
IGL00987:Rnf144b APN 13 47207493 missense possibly damaging 0.57
IGL02712:Rnf144b APN 13 47239779 missense probably damaging 1.00
IGL03002:Rnf144b APN 13 47242883 missense probably damaging 1.00
R0418:Rnf144b UTSW 13 47244490 missense probably benign 0.00
R0464:Rnf144b UTSW 13 47242887 nonsense probably null
R0652:Rnf144b UTSW 13 47220507 missense probably damaging 1.00
R0932:Rnf144b UTSW 13 47220525 missense probably null 0.44
R1472:Rnf144b UTSW 13 47242885 missense probably damaging 1.00
R2341:Rnf144b UTSW 13 47220500 missense probably benign 0.05
R4306:Rnf144b UTSW 13 47242942 missense probably damaging 1.00
R4308:Rnf144b UTSW 13 47242942 missense probably damaging 1.00
R4523:Rnf144b UTSW 13 47207537 missense probably benign 0.08
R5591:Rnf144b UTSW 13 47242954 critical splice donor site probably null
R7323:Rnf144b UTSW 13 47239782 missense probably damaging 1.00
R8676:Rnf144b UTSW 13 47228976 missense probably damaging 1.00
R9159:Rnf144b UTSW 13 47242872 missense probably damaging 1.00
X0064:Rnf144b UTSW 13 47237464 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCACACCTTTGGAAGTGAG -3'
(R):5'- CAAGTTGGGCTCAGGGAATC -3'

Sequencing Primer
(F):5'- CCACACCTTTGGAAGTGAGTTAAAC -3'
(R):5'- AAGAGGCCCCATTGCTAA -3'
Posted On 2019-12-20