Incidental Mutation 'R7887:Dennd6a'
ID609132
Institutional Source Beutler Lab
Gene Symbol Dennd6a
Ensembl Gene ENSMUSG00000040818
Gene NameDENN/MADD domain containing 6A
SynonymsA630054L15Rik, Fam116a
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R7887 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location26573856-26634322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26599657 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 118 (S118P)
Ref Sequence ENSEMBL: ENSMUSP00000039361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037585] [ENSMUST00000203874] [ENSMUST00000224111] [ENSMUST00000224248] [ENSMUST00000224378]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037585
AA Change: S118P

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039361
Gene: ENSMUSG00000040818
AA Change: S118P

DomainStartEndE-ValueType
low complexity region 17 51 N/A INTRINSIC
Pfam:Avl9 59 200 2.9e-11 PFAM
Pfam:DENN 165 371 1.1e-7 PFAM
Pfam:SPA 265 373 4.2e-18 PFAM
low complexity region 379 390 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
low complexity region 554 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203874
AA Change: S118P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144906
Gene: ENSMUSG00000040818
AA Change: S118P

DomainStartEndE-ValueType
low complexity region 17 51 N/A INTRINSIC
Pfam:Avl9 59 200 2.6e-11 PFAM
Pfam:DENN 165 371 9.7e-8 PFAM
Pfam:SPA 265 373 3.7e-18 PFAM
low complexity region 379 390 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224111
Predicted Effect probably benign
Transcript: ENSMUST00000224248
Predicted Effect probably benign
Transcript: ENSMUST00000224378
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Dennd6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dennd6a APN 14 26608613 missense probably damaging 1.00
IGL01011:Dennd6a APN 14 26603054 missense probably damaging 0.99
IGL01395:Dennd6a APN 14 26616901 nonsense probably null
IGL01559:Dennd6a APN 14 26608565 missense probably damaging 1.00
IGL01590:Dennd6a APN 14 26619352 missense probably benign 0.40
IGL02187:Dennd6a APN 14 26606926 missense probably benign
IGL03296:Dennd6a APN 14 26616960 critical splice donor site probably null
R1831:Dennd6a UTSW 14 26606954 missense probably damaging 1.00
R1833:Dennd6a UTSW 14 26606954 missense probably damaging 1.00
R2020:Dennd6a UTSW 14 26612003 missense probably damaging 0.99
R2032:Dennd6a UTSW 14 26604749 missense probably benign 0.42
R2036:Dennd6a UTSW 14 26608119 missense probably damaging 0.99
R3707:Dennd6a UTSW 14 26592391 splice site probably benign
R4112:Dennd6a UTSW 14 26628518 intron probably benign
R4728:Dennd6a UTSW 14 26627420 missense probably null 1.00
R5053:Dennd6a UTSW 14 26608583 missense probably damaging 1.00
R5760:Dennd6a UTSW 14 26612040 missense probably damaging 0.99
R5774:Dennd6a UTSW 14 26579819 missense probably benign
R5775:Dennd6a UTSW 14 26619373 nonsense probably null
R6238:Dennd6a UTSW 14 26616658 critical splice donor site probably null
R6446:Dennd6a UTSW 14 26629534 missense probably damaging 1.00
R6734:Dennd6a UTSW 14 26608619 missense possibly damaging 0.84
R7289:Dennd6a UTSW 14 26612038 missense probably damaging 1.00
R7436:Dennd6a UTSW 14 26579710 nonsense probably null
R7970:Dennd6a UTSW 14 26599657 missense possibly damaging 0.50
RF003:Dennd6a UTSW 14 26629534 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGCAAGGCCAGAATTTC -3'
(R):5'- TCATCACTTACTTAAGGAACACAGC -3'

Sequencing Primer
(F):5'- ACTCATTATGTCGACCAGGATGGC -3'
(R):5'- CTTACTTAAGGAACACAGCTAGATC -3'
Posted On2019-12-20