Incidental Mutation 'R7887:Hacl1'
ID609134
Institutional Source Beutler Lab
Gene Symbol Hacl1
Ensembl Gene ENSMUSG00000021884
Gene Name2-hydroxyacyl-CoA lyase 1
SynonymsHpcl, Phyh2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7887 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31598730-31641286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31634227 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 97 (G97S)
Ref Sequence ENSEMBL: ENSMUSP00000022437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022437] [ENSMUST00000127204] [ENSMUST00000134626] [ENSMUST00000156431] [ENSMUST00000165955] [ENSMUST00000167066] [ENSMUST00000167175] [ENSMUST00000171414]
Predicted Effect probably damaging
Transcript: ENSMUST00000022437
AA Change: G97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022437
Gene: ENSMUSG00000021884
AA Change: G97S

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 185 6.1e-46 PFAM
Pfam:TPP_enzyme_M 206 335 1.9e-34 PFAM
Pfam:TPP_enzyme_C 400 560 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127204
SMART Domains Protein: ENSMUSP00000120452
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 81 1.3e-14 PFAM
Pfam:TPP_enzyme_N 75 159 3.3e-14 PFAM
Pfam:TPP_enzyme_M 179 310 1.5e-34 PFAM
Pfam:TPP_enzyme_C 373 533 7.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134626
SMART Domains Protein: ENSMUSP00000114879
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 67 3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156431
AA Change: G97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114922
Gene: ENSMUSG00000021884
AA Change: G97S

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 186 3.3e-46 PFAM
Pfam:TPP_enzyme_M 206 337 2.1e-34 PFAM
Pfam:TPP_enzyme_C 400 560 1.6e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165955
AA Change: G97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129090
Gene: ENSMUSG00000021884
AA Change: G97S

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 105 3.7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167066
AA Change: G97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132913
Gene: ENSMUSG00000021884
AA Change: G97S

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 131 2.5e-33 PFAM
Pfam:TPP_enzyme_M 180 311 4.7e-34 PFAM
Pfam:TPP_enzyme_C 340 500 6.4e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167175
AA Change: G97S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128588
Gene: ENSMUSG00000115022
AA Change: G97S

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 139 3.6e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171414
AA Change: G97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130268
Gene: ENSMUSG00000021884
AA Change: G97S

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 109 1.3e-27 PFAM
Meta Mutation Damage Score 0.9199 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Hacl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Hacl1 APN 14 31626417 missense probably benign 0.04
IGL01548:Hacl1 APN 14 31640596 missense possibly damaging 0.78
IGL01952:Hacl1 APN 14 31641122 unclassified probably benign
IGL02059:Hacl1 APN 14 31632934 missense probably benign 0.00
IGL02138:Hacl1 APN 14 31630983 missense probably benign 0.05
IGL02637:Hacl1 APN 14 31640501 missense probably damaging 1.00
IGL03235:Hacl1 APN 14 31631038 nonsense probably null
R0502:Hacl1 UTSW 14 31622984 splice site probably benign
R1697:Hacl1 UTSW 14 31621000 splice site probably null
R1800:Hacl1 UTSW 14 31614264 missense probably damaging 1.00
R1829:Hacl1 UTSW 14 31640534 missense probably benign 0.00
R3937:Hacl1 UTSW 14 31634191 splice site probably benign
R3938:Hacl1 UTSW 14 31634191 splice site probably benign
R5004:Hacl1 UTSW 14 31619039 missense probably benign
R5776:Hacl1 UTSW 14 31622871 missense possibly damaging 0.90
R5868:Hacl1 UTSW 14 31619916 missense probably damaging 1.00
R5929:Hacl1 UTSW 14 31616388 missense probably benign 0.04
R6261:Hacl1 UTSW 14 31635771 missense probably damaging 1.00
R6996:Hacl1 UTSW 14 31615423 missense possibly damaging 0.96
R7298:Hacl1 UTSW 14 31616486 missense probably damaging 1.00
R7768:Hacl1 UTSW 14 31616480 missense probably damaging 1.00
R8384:Hacl1 UTSW 14 31634197 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATGAACGTTTGCACCGTTCC -3'
(R):5'- GGAAACCCTAACATACGATGAATTGG -3'

Sequencing Primer
(F):5'- TGACGGCCAGACCACTTC -3'
(R):5'- GATCCATGACCTCTGCTT -3'
Posted On2019-12-20