Incidental Mutation 'R7887:Egr3'
ID609138
Institutional Source Beutler Lab
Gene Symbol Egr3
Ensembl Gene ENSMUSG00000033730
Gene Nameearly growth response 3
SynonymsPilot
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.784) question?
Stock #R7887 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location70077203-70082614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70079202 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 116 (Y116C)
Ref Sequence ENSEMBL: ENSMUSP00000037042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035908] [ENSMUST00000225200]
Predicted Effect probably damaging
Transcript: ENSMUST00000035908
AA Change: Y116C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037042
Gene: ENSMUSG00000033730
AA Change: Y116C

DomainStartEndE-ValueType
Pfam:DUF3446 87 156 3.6e-13 PFAM
ZnF_C2H2 275 299 3.95e-4 SMART
ZnF_C2H2 305 327 5.14e-3 SMART
ZnF_C2H2 333 355 1.45e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000225200
AA Change: Y154C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that belongs to the EGR family of C2H2-type zinc-finger proteins. It is an immediate-early growth response gene which is induced by mitogenic stimulation. The protein encoded by this gene participates in the transcriptional regulation of genes in controling biological rhythm. It may also play a role in a wide variety of processes including muscle development, lymphocyte development, endothelial cell growth and migration, and neuronal development. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mutants exhibit partial postnatal lethality, sensory ataxia, resting tremors, blepharoptosis, scoliosis, muscle spindle agenesis, loss of myelinated proprioceptive neurons, and a defect in the strength of sensory-motor connections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Egr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Egr3 APN 14 70079283 missense probably damaging 1.00
IGL03054:Egr3 UTSW 14 70079112 missense probably damaging 1.00
R1702:Egr3 UTSW 14 70079767 missense probably damaging 1.00
R4796:Egr3 UTSW 14 70077575 missense probably benign 0.15
R5911:Egr3 UTSW 14 70079448 missense probably damaging 0.99
R6514:Egr3 UTSW 14 70078917 missense probably damaging 0.98
R7674:Egr3 UTSW 14 70078077 critical splice donor site probably null
R7970:Egr3 UTSW 14 70079202 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGACCGTGACCTACTTGG -3'
(R):5'- CCTGGAAGGGCTTATGTTCC -3'

Sequencing Primer
(F):5'- ACCTACTTGGGAAAGTTCGC -3'
(R):5'- TCCGGAATGGAGCCCATGTC -3'
Posted On2019-12-20