Incidental Mutation 'R7888:Fam129b'
ID609144
Institutional Source Beutler Lab
Gene Symbol Fam129b
Ensembl Gene ENSMUSG00000026796
Gene Namefamily with sequence similarity 129, member B
Synonyms9130404D14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7888 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32876114-32925254 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 32922125 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 406 (Y406*)
Ref Sequence ENSEMBL: ENSMUSP00000028135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028132] [ENSMUST00000028135] [ENSMUST00000113200]
Predicted Effect probably benign
Transcript: ENSMUST00000028132
SMART Domains Protein: ENSMUSP00000028132
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000028135
AA Change: Y406*
SMART Domains Protein: ENSMUSP00000028135
Gene: ENSMUSG00000026796
AA Change: Y406*

DomainStartEndE-ValueType
PH 69 194 1.81e-2 SMART
low complexity region 594 607 N/A INTRINSIC
low complexity region 685 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113200
SMART Domains Protein: ENSMUSP00000108825
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 G T 14: 8,246,415 Q459K probably benign Het
Ano3 T A 2: 110,666,428 Y792F probably damaging Het
Aoc3 C T 11: 101,332,497 H520Y probably damaging Het
Atp4b A G 8: 13,389,811 F137S probably damaging Het
Blvrb A G 7: 27,465,734 T160A probably damaging Het
Brd2 G A 17: 34,117,021 R73W probably damaging Het
Btaf1 A G 19: 36,965,636 T306A probably benign Het
Ccdc154 G A 17: 25,164,604 V212M possibly damaging Het
Ccdc40 A G 11: 119,229,141 E3G unknown Het
Cenpb T A 2: 131,179,842 E12V probably damaging Het
Cnot8 T C 11: 58,111,311 S57P probably benign Het
Cryba4 T C 5: 112,251,052 E42G probably benign Het
Fam72a T A 1: 131,528,840 I47N probably damaging Het
Gm27027 A C 2: 93,957,535 probably null Het
Itgb2 T C 10: 77,564,644 V697A probably benign Het
Jakmip1 A G 5: 37,104,864 N336D probably damaging Het
Kansl1 T C 11: 104,342,422 T760A probably benign Het
Lrrc37a T A 11: 103,501,481 E1039D probably benign Het
Meaf6 T G 4: 125,109,420 probably null Het
Mpz T C 1: 171,159,635 probably null Het
Mtss1 A T 15: 58,972,524 M82K probably damaging Het
Myo6 T C 9: 80,296,665 S1063P probably damaging Het
Nsun6 T A 2: 14,996,544 E400D probably benign Het
Olfr1057 C A 2: 86,374,926 C162F probably benign Het
Olfr121 A T 17: 37,751,997 N48Y probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr221 A G 14: 52,035,890 S74P probably damaging Het
Olfr364-ps1 A T 2: 37,146,322 M37L probably benign Het
Olfr385 T C 11: 73,589,528 D70G probably damaging Het
Olfr608 T A 7: 103,470,799 Y253* probably null Het
Pfdn5 T A 15: 102,328,589 V92E probably damaging Het
Pik3c2g T C 6: 139,896,744 V801A Het
Psme2b T A 11: 48,945,575 T182S possibly damaging Het
Ptcd3 G A 6: 71,883,447 A592V probably damaging Het
Rabgap1 T A 2: 37,537,307 Y633* probably null Het
Rnf39 A T 17: 36,947,241 T222S probably damaging Het
Scnn1g A G 7: 121,743,655 N277S probably damaging Het
Slc16a13 T G 11: 70,218,980 I232L possibly damaging Het
Slco2b1 T G 7: 99,688,843 R111S unknown Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tmc3 T C 7: 83,600,009 W269R probably damaging Het
Vmn2r4 T C 3: 64,406,522 E346G probably damaging Het
Vps52 A G 17: 33,965,751 N666S probably damaging Het
Wdfy4 C T 14: 33,090,963 D1618N Het
Zfp773 C A 7: 7,132,979 C206F probably benign Het
Other mutations in Fam129b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Fam129b APN 2 32912471 missense probably benign 0.04
IGL01072:Fam129b APN 2 32912415 unclassified probably benign
IGL01874:Fam129b APN 2 32905767 critical splice acceptor site probably null
IGL02302:Fam129b APN 2 32921123 missense probably benign
IGL02681:Fam129b APN 2 32911390 missense probably benign 0.05
IGL03126:Fam129b APN 2 32876386 missense possibly damaging 0.95
IGL03240:Fam129b APN 2 32922097 missense probably benign 0.00
R0125:Fam129b UTSW 2 32923821 missense probably benign 0.17
R0948:Fam129b UTSW 2 32922860 missense probably damaging 1.00
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R2130:Fam129b UTSW 2 32923647 missense probably benign 0.34
R2408:Fam129b UTSW 2 32923470 missense probably damaging 1.00
R4881:Fam129b UTSW 2 32922578 nonsense probably null
R5506:Fam129b UTSW 2 32920982 missense probably damaging 0.96
R5748:Fam129b UTSW 2 32919569 missense probably damaging 1.00
R5857:Fam129b UTSW 2 32909908 missense probably benign 0.28
R6011:Fam129b UTSW 2 32922865 missense probably damaging 0.99
R6088:Fam129b UTSW 2 32923123 missense probably damaging 1.00
R6720:Fam129b UTSW 2 32905826 missense probably damaging 1.00
R6763:Fam129b UTSW 2 32911448 critical splice donor site probably null
R6769:Fam129b UTSW 2 32895654
R7296:Fam129b UTSW 2 32922642 missense possibly damaging 0.74
R7769:Fam129b UTSW 2 32919832 missense possibly damaging 0.93
R7971:Fam129b UTSW 2 32922125 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACAGTCTGCCTTTAGGTTCC -3'
(R):5'- AGTGAGCAACGGGTGTTCTG -3'

Sequencing Primer
(F):5'- TCCTGGGCTTGCCCGAATG -3'
(R):5'- CAACGGGTGTTCTGGGAGG -3'
Posted On2019-12-20