Incidental Mutation 'R7888:Cryba4'
ID609152
Institutional Source Beutler Lab
Gene Symbol Cryba4
Ensembl Gene ENSMUSG00000066975
Gene Namecrystallin, beta A4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7888 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location112246493-112252518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112251052 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 42 (E42G)
Ref Sequence ENSEMBL: ENSMUSP00000083826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031286] [ENSMUST00000086629] [ENSMUST00000112375] [ENSMUST00000112383] [ENSMUST00000112385] [ENSMUST00000131673]
Predicted Effect probably benign
Transcript: ENSMUST00000031286
SMART Domains Protein: ENSMUSP00000031286
Gene: ENSMUSG00000029343

DomainStartEndE-ValueType
low complexity region 19 47 N/A INTRINSIC
XTALbg 58 140 9.71e-40 SMART
XTALbg 148 230 5.8e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086629
AA Change: E42G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000083826
Gene: ENSMUSG00000066975
AA Change: E42G

DomainStartEndE-ValueType
XTALbg 13 97 1.08e-37 SMART
XTALbg 106 194 2.59e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112375
SMART Domains Protein: ENSMUSP00000107994
Gene: ENSMUSG00000029343

DomainStartEndE-ValueType
low complexity region 19 47 N/A INTRINSIC
XTALbg 58 140 9.71e-40 SMART
XTALbg 148 230 5.8e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112383
AA Change: E29G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108002
Gene: ENSMUSG00000066975
AA Change: E29G

DomainStartEndE-ValueType
XTALbg 1 84 1.71e-35 SMART
XTALbg 93 181 2.59e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112385
AA Change: E42G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108004
Gene: ENSMUSG00000066975
AA Change: E42G

DomainStartEndE-ValueType
XTALbg 13 97 1.08e-37 SMART
XTALbg 106 194 2.59e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131673
SMART Domains Protein: ENSMUSP00000118399
Gene: ENSMUSG00000029343

DomainStartEndE-ValueType
low complexity region 19 47 N/A INTRINSIC
XTALbg 58 140 9.71e-40 SMART
XTALbg 148 230 5.8e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a member of the crystallin family of proteins that contribute to the transparency and refractive properties of the ocular lens. Certain mutations in the human ortholog of this gene are associated with cataract and bilateral microphthalmia. This gene is located adjacent to a related crystallin gene on chromosome 5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 G T 14: 8,246,415 Q459K probably benign Het
Ano3 T A 2: 110,666,428 Y792F probably damaging Het
Aoc3 C T 11: 101,332,497 H520Y probably damaging Het
Atp4b A G 8: 13,389,811 F137S probably damaging Het
Blvrb A G 7: 27,465,734 T160A probably damaging Het
Brd2 G A 17: 34,117,021 R73W probably damaging Het
Btaf1 A G 19: 36,965,636 T306A probably benign Het
Ccdc154 G A 17: 25,164,604 V212M possibly damaging Het
Ccdc40 A G 11: 119,229,141 E3G unknown Het
Cenpb T A 2: 131,179,842 E12V probably damaging Het
Cnot8 T C 11: 58,111,311 S57P probably benign Het
Fam129b T A 2: 32,922,125 Y406* probably null Het
Fam72a T A 1: 131,528,840 I47N probably damaging Het
Gm27027 A C 2: 93,957,535 probably null Het
Itgb2 T C 10: 77,564,644 V697A probably benign Het
Jakmip1 A G 5: 37,104,864 N336D probably damaging Het
Kansl1 T C 11: 104,342,422 T760A probably benign Het
Lrrc37a T A 11: 103,501,481 E1039D probably benign Het
Meaf6 T G 4: 125,109,420 probably null Het
Mpz T C 1: 171,159,635 probably null Het
Mtss1 A T 15: 58,972,524 M82K probably damaging Het
Myo6 T C 9: 80,296,665 S1063P probably damaging Het
Nsun6 T A 2: 14,996,544 E400D probably benign Het
Olfr1057 C A 2: 86,374,926 C162F probably benign Het
Olfr121 A T 17: 37,751,997 N48Y probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr221 A G 14: 52,035,890 S74P probably damaging Het
Olfr364-ps1 A T 2: 37,146,322 M37L probably benign Het
Olfr385 T C 11: 73,589,528 D70G probably damaging Het
Olfr608 T A 7: 103,470,799 Y253* probably null Het
Pfdn5 T A 15: 102,328,589 V92E probably damaging Het
Pik3c2g T C 6: 139,896,744 V801A Het
Psme2b T A 11: 48,945,575 T182S possibly damaging Het
Ptcd3 G A 6: 71,883,447 A592V probably damaging Het
Rabgap1 T A 2: 37,537,307 Y633* probably null Het
Rnf39 A T 17: 36,947,241 T222S probably damaging Het
Scnn1g A G 7: 121,743,655 N277S probably damaging Het
Slc16a13 T G 11: 70,218,980 I232L possibly damaging Het
Slco2b1 T G 7: 99,688,843 R111S unknown Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tmc3 T C 7: 83,600,009 W269R probably damaging Het
Vmn2r4 T C 3: 64,406,522 E346G probably damaging Het
Vps52 A G 17: 33,965,751 N666S probably damaging Het
Wdfy4 C T 14: 33,090,963 D1618N Het
Zfp773 C A 7: 7,132,979 C206F probably benign Het
Other mutations in Cryba4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Cryba4 APN 5 112251009 unclassified probably benign
R0741:Cryba4 UTSW 5 112246688 missense probably damaging 1.00
R5622:Cryba4 UTSW 5 112251124 missense probably damaging 1.00
R5811:Cryba4 UTSW 5 112251071 missense probably benign
R6644:Cryba4 UTSW 5 112246762 missense probably damaging 1.00
R7008:Cryba4 UTSW 5 112251782 missense probably benign
R7554:Cryba4 UTSW 5 112251103 missense probably damaging 0.99
R7556:Cryba4 UTSW 5 112251103 missense probably damaging 0.99
R7671:Cryba4 UTSW 5 112248173 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTGTCCCTTACAACCTGAG -3'
(R):5'- AGGCATGTGACCTCTGCTTTAC -3'

Sequencing Primer
(F):5'- ACACTCTTCAGCACTTGGGAG -3'
(R):5'- ATGTGACCTCTGCTTTACCTGTTTG -3'
Posted On2019-12-20