Incidental Mutation 'R7888:Zfp773'
ID609155
Institutional Source Beutler Lab
Gene Symbol Zfp773
Ensembl Gene ENSMUSG00000063535
Gene Namezinc finger protein 773
Synonyms2810409K11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7888 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location7127073-7136755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7132979 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 206 (C206F)
Ref Sequence ENSEMBL: ENSMUSP00000032622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032622] [ENSMUST00000211240]
Predicted Effect probably benign
Transcript: ENSMUST00000032622
AA Change: C206F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000032622
Gene: ENSMUSG00000063535
AA Change: C206F

DomainStartEndE-ValueType
KRAB 75 134 6.82e-8 SMART
ZnF_C2H2 241 263 1.31e0 SMART
ZnF_C2H2 269 291 1.5e-4 SMART
ZnF_C2H2 297 319 4.17e-3 SMART
ZnF_C2H2 325 347 2.05e-2 SMART
ZnF_C2H2 353 375 2.24e-3 SMART
ZnF_C2H2 381 403 8.81e-2 SMART
ZnF_C2H2 409 431 7.26e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211240
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 G T 14: 8,246,415 Q459K probably benign Het
Ano3 T A 2: 110,666,428 Y792F probably damaging Het
Aoc3 C T 11: 101,332,497 H520Y probably damaging Het
Atp4b A G 8: 13,389,811 F137S probably damaging Het
Bcorl1 G A X: 48,361,607 V11M unknown Het
Blvrb A G 7: 27,465,734 T160A probably damaging Het
Brd2 G A 17: 34,117,021 R73W probably damaging Het
Btaf1 A G 19: 36,965,636 T306A probably benign Het
Ccdc154 G A 17: 25,164,604 V212M possibly damaging Het
Ccdc40 A G 11: 119,229,141 E3G unknown Het
Cenpb T A 2: 131,179,842 E12V probably damaging Het
Cnot8 T C 11: 58,111,311 S57P probably benign Het
Cryba4 T C 5: 112,251,052 E42G probably benign Het
Fam129b T A 2: 32,922,125 Y406* probably null Het
Fam72a T A 1: 131,528,840 I47N probably damaging Het
Itgb2 T C 10: 77,564,644 V697A probably benign Het
Jakmip1 A G 5: 37,104,864 N336D probably damaging Het
Kansl1 T C 11: 104,342,422 T760A probably benign Het
Lrrc37a T A 11: 103,501,481 E1039D probably benign Het
Mpz T C 1: 171,159,635 probably null Het
Mtss1 A T 15: 58,972,524 M82K probably damaging Het
Myo6 T C 9: 80,296,665 S1063P probably damaging Het
Nsun6 T A 2: 14,996,544 E400D probably benign Het
Olfr1057 C A 2: 86,374,926 C162F probably benign Het
Olfr121 A T 17: 37,751,997 N48Y probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr221 A G 14: 52,035,890 S74P probably damaging Het
Olfr364-ps1 A T 2: 37,146,322 M37L probably benign Het
Olfr385 T C 11: 73,589,528 D70G probably damaging Het
Olfr608 T A 7: 103,470,799 Y253* probably null Het
Pfdn5 T A 15: 102,328,589 V92E probably damaging Het
Pik3c2g T C 6: 139,896,744 V801A Het
Psme2b T A 11: 48,945,575 T182S possibly damaging Het
Ptcd3 G A 6: 71,883,447 A592V probably damaging Het
Rabgap1 T A 2: 37,537,307 Y633* probably null Het
Rnf39 A T 17: 36,947,241 T222S probably damaging Het
Scnn1g A G 7: 121,743,655 N277S probably damaging Het
Slc16a13 T G 11: 70,218,980 I232L possibly damaging Het
Slco2b1 T G 7: 99,688,843 R111S unknown Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tmc3 T C 7: 83,600,009 W269R probably damaging Het
Vmn2r4 T C 3: 64,406,522 E346G probably damaging Het
Vps52 A G 17: 33,965,751 N666S probably damaging Het
Wdfy4 C T 14: 33,090,963 D1618N Het
Other mutations in Zfp773
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Zfp773 APN 7 7132684 missense probably damaging 1.00
IGL00780:Zfp773 APN 7 7133114 missense probably benign 0.00
IGL01348:Zfp773 APN 7 7135315 missense possibly damaging 0.93
IGL02224:Zfp773 APN 7 7132976 missense probably benign 0.00
IGL02447:Zfp773 APN 7 7136656 utr 5 prime probably benign
IGL02869:Zfp773 APN 7 7134233 missense probably benign 0.22
R0505:Zfp773 UTSW 7 7133024 missense probably benign 0.03
R0585:Zfp773 UTSW 7 7132575 missense probably benign 0.21
R0804:Zfp773 UTSW 7 7133093 intron probably benign
R0846:Zfp773 UTSW 7 7132692 missense probably damaging 1.00
R1179:Zfp773 UTSW 7 7133093 intron probably benign
R2847:Zfp773 UTSW 7 7133093 intron probably benign
R3841:Zfp773 UTSW 7 7132391 missense possibly damaging 0.92
R4116:Zfp773 UTSW 7 7133093 intron probably benign
R4638:Zfp773 UTSW 7 7135336 missense probably damaging 1.00
R5126:Zfp773 UTSW 7 7136624 missense unknown
R6142:Zfp773 UTSW 7 7132482 missense probably benign 0.00
R7072:Zfp773 UTSW 7 7132875 missense probably benign 0.15
R7232:Zfp773 UTSW 7 7132985 missense probably benign 0.14
R7748:Zfp773 UTSW 7 7132908 missense probably benign 0.04
R7971:Zfp773 UTSW 7 7132979 missense probably benign 0.00
RF007:Zfp773 UTSW 7 7132690 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGACTTCTCACACTCGCTAC -3'
(R):5'- GAGCTTGCAAAGATACCTTGTGAG -3'

Sequencing Primer
(F):5'- GCTACACTTAAAAGGCTTTTCTCCAG -3'
(R):5'- TGTGAGCAGACCCTTTCAACG -3'
Posted On2019-12-20