Mutagenetix > Incidental Mutation

Incidental Mutation 'R7888:Scnn1g'

609160

Institutional Source

Beutler Lab

Gene Symbol

Scnn1g

Ensembl Gene

ENSMUSG00000000216

Gene Name

sodium channel, nonvoltage-gated 1 gamma

Synonyms

ENaC gamma

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.667) question?

Stock #

R7888 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121734479-121768475 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121743655 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 277 (N277S)

Ref Sequence

ENSEMBL: ENSMUSP00000000221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000221]

AlphaFold

Q9WU39

Predicted Effect

probably damaging
Transcript: ENSMUST00000000221
AA Change: N277S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: N277S

Domain	Start	End	E-Value	Type
Pfam:ASC	32	558	6.4e-91	PFAM
low complexity region	618	631	N/A	INTRINSIC

Meta Mutation Damage Score

0.4839

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	G	T	14: 8,246,415	Q459K	probably benign	Het
Ano3	T	A	2: 110,666,428	Y792F	probably damaging	Het
Aoc3	C	T	11: 101,332,497	H520Y	probably damaging	Het
Atp4b	A	G	8: 13,389,811	F137S	probably damaging	Het
Blvrb	A	G	7: 27,465,734	T160A	probably damaging	Het
Brd2	G	A	17: 34,117,021	R73W	probably damaging	Het
Btaf1	A	G	19: 36,965,636	T306A	probably benign	Het
Ccdc154	G	A	17: 25,164,604	V212M	possibly damaging	Het
Ccdc40	A	G	11: 119,229,141	E3G	unknown	Het
Cenpb	T	A	2: 131,179,842	E12V	probably damaging	Het
Cnot8	T	C	11: 58,111,311	S57P	probably benign	Het
Cryba4	T	C	5: 112,251,052	E42G	probably benign	Het
Fam129b	T	A	2: 32,922,125	Y406*	probably null	Het
Fam72a	T	A	1: 131,528,840	I47N	probably damaging	Het
Gm27027	A	C	2: 93,957,535		probably null	Het
Itgb2	T	C	10: 77,564,644	V697A	probably benign	Het
Jakmip1	A	G	5: 37,104,864	N336D	probably damaging	Het
Kansl1	T	C	11: 104,342,422	T760A	probably benign	Het
Lrrc37a	T	A	11: 103,501,481	E1039D	probably benign	Het
Meaf6	T	G	4: 125,109,420		probably null	Het
Mpz	T	C	1: 171,159,635		probably null	Het
Mtss1	A	T	15: 58,972,524	M82K	probably damaging	Het
Myo6	T	C	9: 80,296,665	S1063P	probably damaging	Het
Nsun6	T	A	2: 14,996,544	E400D	probably benign	Het
Olfr1057	C	A	2: 86,374,926	C162F	probably benign	Het
Olfr121	A	T	17: 37,751,997	N48Y	probably damaging	Het
Olfr1395	T	C	11: 49,148,439	Y61H	probably damaging	Het
Olfr221	A	G	14: 52,035,890	S74P	probably damaging	Het
Olfr364-ps1	A	T	2: 37,146,322	M37L	probably benign	Het
Olfr385	T	C	11: 73,589,528	D70G	probably damaging	Het
Olfr608	T	A	7: 103,470,799	Y253*	probably null	Het
Pfdn5	T	A	15: 102,328,589	V92E	probably damaging	Het
Pik3c2g	T	C	6: 139,896,744	V801A		Het
Psme2b	T	A	11: 48,945,575	T182S	possibly damaging	Het
Ptcd3	G	A	6: 71,883,447	A592V	probably damaging	Het
Rabgap1	T	A	2: 37,537,307	Y633*	probably null	Het
Rnf39	A	T	17: 36,947,241	T222S	probably damaging	Het
Slc16a13	T	G	11: 70,218,980	I232L	possibly damaging	Het
Slco2b1	T	G	7: 99,688,843	R111S	unknown	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Tmc3	T	C	7: 83,600,009	W269R	probably damaging	Het
Vmn2r4	T	C	3: 64,406,522	E346G	probably damaging	Het
Vps52	A	G	17: 33,965,751	N666S	probably damaging	Het
Wdfy4	C	T	14: 33,090,963	D1618N		Het
Zfp773	C	A	7: 7,132,979	C206F	probably benign	Het

Other mutations in Scnn1g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Scnn1g	APN	7	121740437	missense	probably benign	0.00
IGL01824:Scnn1g	APN	7	121766293	missense	probably benign	0.00
IGL02133:Scnn1g	APN	7	121743699	missense	probably damaging	1.00
IGL02529:Scnn1g	APN	7	121742446	splice site	probably benign
IGL02814:Scnn1g	APN	7	121740365	missense	probably damaging	1.00
IGL03091:Scnn1g	APN	7	121746683	missense	probably damaging	1.00
IGL03253:Scnn1g	APN	7	121737933	nonsense	probably null
PIT4504001:Scnn1g	UTSW	7	121742331	missense	probably benign	0.30
R0230:Scnn1g	UTSW	7	121746761	splice site	probably benign
R0324:Scnn1g	UTSW	7	121740555	missense	possibly damaging	0.62
R0367:Scnn1g	UTSW	7	121746579	splice site	probably benign
R0534:Scnn1g	UTSW	7	121767424	missense	probably benign	0.00
R1747:Scnn1g	UTSW	7	121760463	missense	probably damaging	0.99
R2004:Scnn1g	UTSW	7	121738188	nonsense	probably null
R2197:Scnn1g	UTSW	7	121767296	missense	probably damaging	1.00
R4396:Scnn1g	UTSW	7	121740427	missense	probably benign	0.01
R4804:Scnn1g	UTSW	7	121763080	frame shift	probably null
R4805:Scnn1g	UTSW	7	121746602	missense	probably damaging	1.00
R5219:Scnn1g	UTSW	7	121766266	missense	probably damaging	1.00
R5757:Scnn1g	UTSW	7	121738215	missense	probably damaging	1.00
R5882:Scnn1g	UTSW	7	121767358	missense	possibly damaging	0.79
R5910:Scnn1g	UTSW	7	121738095	missense	probably damaging	0.99
R6381:Scnn1g	UTSW	7	121767499	missense	probably benign	0.00
R6666:Scnn1g	UTSW	7	121767388	missense	probably benign	0.00
R6735:Scnn1g	UTSW	7	121742263	missense	probably benign	0.02
R6813:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6860:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6887:Scnn1g	UTSW	7	121760444	missense	probably benign	0.01
R7289:Scnn1g	UTSW	7	121738081	nonsense	probably null
R7488:Scnn1g	UTSW	7	121763434	missense	probably benign	0.00
R7630:Scnn1g	UTSW	7	121760481	missense	probably damaging	1.00
R7917:Scnn1g	UTSW	7	121743693	missense	probably damaging	1.00
R9051:Scnn1g	UTSW	7	121742343	missense	possibly damaging	0.86
R9312:Scnn1g	UTSW	7	121740595	missense	probably benign	0.00
Z1177:Scnn1g	UTSW	7	121760475	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCAACCCTAGCAAATGAGGAG -3'
(R):5'- AGAATGCCTTTGCTTTAGGGC -3'

Sequencing Primer
(F):5'- GGAGTCATTTCATTTCATCCGAGAG -3'
(R):5'- CTTTAGGGCTAGGTGGAGAGGATG -3'

Posted On

2019-12-20