Incidental Mutation 'R7888:Sltm'
ID 609162
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene Name SAFB-like, transcription modulator
Synonyms 5730455C01Rik, 5730555F13Rik, 9130215G10Rik
MMRRC Submission 045940-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R7888 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 70450036-70499516 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 70493955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 802 (P802R)
Ref Sequence ENSEMBL: ENSMUSP00000049112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000216816] [ENSMUST00000217593]
AlphaFold Q8CH25
Predicted Effect possibly damaging
Transcript: ENSMUST00000049263
AA Change: P802R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: P802R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216816
AA Change: P784R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000217593
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 G T 14: 8,246,415 (GRCm38) Q459K probably benign Het
Ano3 T A 2: 110,496,773 (GRCm39) Y792F probably damaging Het
Aoc3 C T 11: 101,223,323 (GRCm39) H520Y probably damaging Het
Atp4b A G 8: 13,439,811 (GRCm39) F137S probably damaging Het
Blvrb A G 7: 27,165,159 (GRCm39) T160A probably damaging Het
Brd2 G A 17: 34,335,995 (GRCm39) R73W probably damaging Het
Btaf1 A G 19: 36,943,036 (GRCm39) T306A probably benign Het
Ccdc154 G A 17: 25,383,578 (GRCm39) V212M possibly damaging Het
Ccdc40 A G 11: 119,119,967 (GRCm39) E3G unknown Het
Cenpb T A 2: 131,021,762 (GRCm39) E12V probably damaging Het
Cnot8 T C 11: 58,002,137 (GRCm39) S57P probably benign Het
Cryba4 T C 5: 112,398,918 (GRCm39) E42G probably benign Het
Fam72a T A 1: 131,456,578 (GRCm39) I47N probably damaging Het
Gm27027 A C 2: 93,787,880 (GRCm39) probably null Het
Itgb2 T C 10: 77,400,478 (GRCm39) V697A probably benign Het
Jakmip1 A G 5: 37,262,208 (GRCm39) N336D probably damaging Het
Kansl1 T C 11: 104,233,248 (GRCm39) T760A probably benign Het
Lrrc37a T A 11: 103,392,307 (GRCm39) E1039D probably benign Het
Meaf6 T G 4: 125,003,213 (GRCm39) probably null Het
Mpz T C 1: 170,987,204 (GRCm39) probably null Het
Mtss1 A T 15: 58,844,373 (GRCm39) M82K probably damaging Het
Myo6 T C 9: 80,203,947 (GRCm39) S1063P probably damaging Het
Niban2 T A 2: 32,812,137 (GRCm39) Y406* probably null Het
Nsun6 T A 2: 15,001,355 (GRCm39) E400D probably benign Het
Or10al5 A T 17: 38,062,888 (GRCm39) N48Y probably damaging Het
Or1e26 T C 11: 73,480,354 (GRCm39) D70G probably damaging Het
Or1l4b A T 2: 37,036,334 (GRCm39) M37L probably benign Het
Or2t26 T C 11: 49,039,266 (GRCm39) Y61H probably damaging Het
Or52ae7 T A 7: 103,120,006 (GRCm39) Y253* probably null Het
Or5au1 A G 14: 52,273,347 (GRCm39) S74P probably damaging Het
Or8j3b C A 2: 86,205,270 (GRCm39) C162F probably benign Het
Pfdn5 T A 15: 102,237,024 (GRCm39) V92E probably damaging Het
Pik3c2g T C 6: 139,842,470 (GRCm39) V801A Het
Psme2b T A 11: 48,836,402 (GRCm39) T182S possibly damaging Het
Ptcd3 G A 6: 71,860,431 (GRCm39) A592V probably damaging Het
Rabgap1 T A 2: 37,427,319 (GRCm39) Y633* probably null Het
Rnf39 A T 17: 37,258,133 (GRCm39) T222S probably damaging Het
Scnn1g A G 7: 121,342,878 (GRCm39) N277S probably damaging Het
Slc16a13 T G 11: 70,109,806 (GRCm39) I232L possibly damaging Het
Slco2b1 T G 7: 99,338,050 (GRCm39) R111S unknown Het
Tmc3 T C 7: 83,249,217 (GRCm39) W269R probably damaging Het
Vmn2r4 T C 3: 64,313,943 (GRCm39) E346G probably damaging Het
Vps52 A G 17: 34,184,725 (GRCm39) N666S probably damaging Het
Wdfy4 C T 14: 32,812,920 (GRCm39) D1618N Het
Zfp773 C A 7: 7,135,978 (GRCm39) C206F probably benign Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70,486,624 (GRCm39) missense probably damaging 1.00
IGL01755:Sltm APN 9 70,491,204 (GRCm39) splice site probably null
IGL01782:Sltm APN 9 70,480,923 (GRCm39) missense probably damaging 1.00
IGL02441:Sltm APN 9 70,494,467 (GRCm39) missense probably damaging 1.00
IGL02831:Sltm APN 9 70,492,147 (GRCm39) missense probably damaging 1.00
IGL02947:Sltm APN 9 70,498,946 (GRCm39) missense probably benign 0.05
IGL03166:Sltm APN 9 70,450,251 (GRCm39) missense possibly damaging 0.87
R0288:Sltm UTSW 9 70,486,633 (GRCm39) missense probably damaging 1.00
R0555:Sltm UTSW 9 70,493,363 (GRCm39) missense probably damaging 1.00
R0815:Sltm UTSW 9 70,469,190 (GRCm39) missense probably benign 0.04
R0863:Sltm UTSW 9 70,469,190 (GRCm39) missense probably benign 0.04
R1315:Sltm UTSW 9 70,450,347 (GRCm39) missense probably benign 0.13
R1533:Sltm UTSW 9 70,493,948 (GRCm39) missense probably damaging 1.00
R1676:Sltm UTSW 9 70,480,929 (GRCm39) missense probably damaging 1.00
R1764:Sltm UTSW 9 70,469,082 (GRCm39) missense probably benign 0.00
R1845:Sltm UTSW 9 70,450,314 (GRCm39) missense possibly damaging 0.60
R2049:Sltm UTSW 9 70,488,583 (GRCm39) missense probably benign 0.00
R2163:Sltm UTSW 9 70,498,964 (GRCm39) missense probably damaging 0.99
R3410:Sltm UTSW 9 70,493,240 (GRCm39) missense probably damaging 0.97
R4323:Sltm UTSW 9 70,487,529 (GRCm39) missense probably benign
R4632:Sltm UTSW 9 70,486,651 (GRCm39) missense possibly damaging 0.86
R4748:Sltm UTSW 9 70,488,647 (GRCm39) missense probably damaging 1.00
R4756:Sltm UTSW 9 70,498,892 (GRCm39) missense possibly damaging 0.57
R4782:Sltm UTSW 9 70,496,339 (GRCm39) missense probably damaging 1.00
R4799:Sltm UTSW 9 70,496,339 (GRCm39) missense probably damaging 1.00
R4887:Sltm UTSW 9 70,496,260 (GRCm39) missense probably damaging 1.00
R5221:Sltm UTSW 9 70,486,685 (GRCm39) missense probably damaging 1.00
R5263:Sltm UTSW 9 70,492,081 (GRCm39) missense unknown
R5982:Sltm UTSW 9 70,494,086 (GRCm39) missense probably damaging 1.00
R6297:Sltm UTSW 9 70,488,641 (GRCm39) missense probably damaging 0.99
R6456:Sltm UTSW 9 70,450,269 (GRCm39) missense probably damaging 1.00
R6658:Sltm UTSW 9 70,488,644 (GRCm39) missense probably damaging 1.00
R6720:Sltm UTSW 9 70,480,992 (GRCm39) missense probably damaging 1.00
R6770:Sltm UTSW 9 70,492,059 (GRCm39) missense unknown
R6923:Sltm UTSW 9 70,481,892 (GRCm39) missense probably damaging 1.00
R7051:Sltm UTSW 9 70,466,348 (GRCm39) missense probably damaging 1.00
R7166:Sltm UTSW 9 70,492,132 (GRCm39) missense probably damaging 1.00
R7257:Sltm UTSW 9 70,451,247 (GRCm39) splice site probably null
R7400:Sltm UTSW 9 70,493,352 (GRCm39) missense probably damaging 1.00
R7438:Sltm UTSW 9 70,480,748 (GRCm39) missense unknown
R7484:Sltm UTSW 9 70,481,179 (GRCm39) missense unknown
R7630:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7631:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7632:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7633:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7862:Sltm UTSW 9 70,479,446 (GRCm39) nonsense probably null
R7885:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7886:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7889:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7891:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7915:Sltm UTSW 9 70,494,431 (GRCm39) missense probably damaging 1.00
R8030:Sltm UTSW 9 70,493,261 (GRCm39) nonsense probably null
R8062:Sltm UTSW 9 70,480,779 (GRCm39) missense unknown
R8099:Sltm UTSW 9 70,493,360 (GRCm39) missense probably damaging 1.00
R8374:Sltm UTSW 9 70,469,227 (GRCm39) missense probably null
R8698:Sltm UTSW 9 70,494,352 (GRCm39) missense probably benign 0.27
R9541:Sltm UTSW 9 70,481,057 (GRCm39) missense unknown
R9563:Sltm UTSW 9 70,480,841 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CAGTAATGAGGGCTTTTCTGGC -3'
(R):5'- TCTAGAAGGATTGGGCACAGTC -3'

Sequencing Primer
(F):5'- GCAGCCTTGCCATAATTTCC -3'
(R):5'- AAGGATTGGGCACAGTCTCTCG -3'
Posted On 2019-12-20