Incidental Mutation 'R7888:Sltm'
ID609162
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene NameSAFB-like, transcription modulator
Synonyms9130215G10Rik, 5730555F13Rik, 5730455C01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R7888 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location70542754-70592234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 70586673 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 802 (P802R)
Ref Sequence ENSEMBL: ENSMUSP00000049112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000216816] [ENSMUST00000217593]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049263
AA Change: P802R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: P802R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216816
AA Change: P784R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000217593
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 G T 14: 8,246,415 Q459K probably benign Het
Ano3 T A 2: 110,666,428 Y792F probably damaging Het
Aoc3 C T 11: 101,332,497 H520Y probably damaging Het
Atp4b A G 8: 13,389,811 F137S probably damaging Het
Blvrb A G 7: 27,465,734 T160A probably damaging Het
Brd2 G A 17: 34,117,021 R73W probably damaging Het
Btaf1 A G 19: 36,965,636 T306A probably benign Het
Ccdc154 G A 17: 25,164,604 V212M possibly damaging Het
Ccdc40 A G 11: 119,229,141 E3G unknown Het
Cenpb T A 2: 131,179,842 E12V probably damaging Het
Cnot8 T C 11: 58,111,311 S57P probably benign Het
Cryba4 T C 5: 112,251,052 E42G probably benign Het
Fam129b T A 2: 32,922,125 Y406* probably null Het
Fam72a T A 1: 131,528,840 I47N probably damaging Het
Gm27027 A C 2: 93,957,535 probably null Het
Itgb2 T C 10: 77,564,644 V697A probably benign Het
Jakmip1 A G 5: 37,104,864 N336D probably damaging Het
Kansl1 T C 11: 104,342,422 T760A probably benign Het
Lrrc37a T A 11: 103,501,481 E1039D probably benign Het
Meaf6 T G 4: 125,109,420 probably null Het
Mpz T C 1: 171,159,635 probably null Het
Mtss1 A T 15: 58,972,524 M82K probably damaging Het
Myo6 T C 9: 80,296,665 S1063P probably damaging Het
Nsun6 T A 2: 14,996,544 E400D probably benign Het
Olfr1057 C A 2: 86,374,926 C162F probably benign Het
Olfr121 A T 17: 37,751,997 N48Y probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr221 A G 14: 52,035,890 S74P probably damaging Het
Olfr364-ps1 A T 2: 37,146,322 M37L probably benign Het
Olfr385 T C 11: 73,589,528 D70G probably damaging Het
Olfr608 T A 7: 103,470,799 Y253* probably null Het
Pfdn5 T A 15: 102,328,589 V92E probably damaging Het
Pik3c2g T C 6: 139,896,744 V801A Het
Psme2b T A 11: 48,945,575 T182S possibly damaging Het
Ptcd3 G A 6: 71,883,447 A592V probably damaging Het
Rabgap1 T A 2: 37,537,307 Y633* probably null Het
Rnf39 A T 17: 36,947,241 T222S probably damaging Het
Scnn1g A G 7: 121,743,655 N277S probably damaging Het
Slc16a13 T G 11: 70,218,980 I232L possibly damaging Het
Slco2b1 T G 7: 99,688,843 R111S unknown Het
Tmc3 T C 7: 83,600,009 W269R probably damaging Het
Vmn2r4 T C 3: 64,406,522 E346G probably damaging Het
Vps52 A G 17: 33,965,751 N666S probably damaging Het
Wdfy4 C T 14: 33,090,963 D1618N Het
Zfp773 C A 7: 7,132,979 C206F probably benign Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70579342 missense probably damaging 1.00
IGL01755:Sltm APN 9 70583922 splice site probably null
IGL01782:Sltm APN 9 70573641 missense probably damaging 1.00
IGL02441:Sltm APN 9 70587185 missense probably damaging 1.00
IGL02831:Sltm APN 9 70584865 missense probably damaging 1.00
IGL02947:Sltm APN 9 70591664 missense probably benign 0.05
IGL03166:Sltm APN 9 70542969 missense possibly damaging 0.87
R0288:Sltm UTSW 9 70579351 missense probably damaging 1.00
R0555:Sltm UTSW 9 70586081 missense probably damaging 1.00
R0815:Sltm UTSW 9 70561908 missense probably benign 0.04
R0863:Sltm UTSW 9 70561908 missense probably benign 0.04
R1315:Sltm UTSW 9 70543065 missense probably benign 0.13
R1533:Sltm UTSW 9 70586666 missense probably damaging 1.00
R1676:Sltm UTSW 9 70573647 missense probably damaging 1.00
R1764:Sltm UTSW 9 70561800 missense probably benign 0.00
R1845:Sltm UTSW 9 70543032 missense possibly damaging 0.60
R2049:Sltm UTSW 9 70581301 missense probably benign 0.00
R2163:Sltm UTSW 9 70591682 missense probably damaging 0.99
R3410:Sltm UTSW 9 70585958 missense probably damaging 0.97
R4323:Sltm UTSW 9 70580247 missense probably benign
R4632:Sltm UTSW 9 70579369 missense possibly damaging 0.86
R4748:Sltm UTSW 9 70581365 missense probably damaging 1.00
R4756:Sltm UTSW 9 70591610 missense possibly damaging 0.57
R4782:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4799:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4887:Sltm UTSW 9 70588978 missense probably damaging 1.00
R5221:Sltm UTSW 9 70579403 missense probably damaging 1.00
R5263:Sltm UTSW 9 70584799 missense unknown
R5982:Sltm UTSW 9 70586804 missense probably damaging 1.00
R6297:Sltm UTSW 9 70581359 missense probably damaging 0.99
R6456:Sltm UTSW 9 70542987 missense probably damaging 1.00
R6658:Sltm UTSW 9 70581362 missense probably damaging 1.00
R6720:Sltm UTSW 9 70573710 missense probably damaging 1.00
R6770:Sltm UTSW 9 70584777 missense unknown
R6923:Sltm UTSW 9 70574610 missense probably damaging 1.00
R7051:Sltm UTSW 9 70559066 missense probably damaging 1.00
R7166:Sltm UTSW 9 70584850 missense probably damaging 1.00
R7257:Sltm UTSW 9 70543965 splice site probably null
R7400:Sltm UTSW 9 70586070 missense probably damaging 1.00
R7438:Sltm UTSW 9 70573466 missense unknown
R7484:Sltm UTSW 9 70573897 missense unknown
R7630:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7631:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7632:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7633:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7862:Sltm UTSW 9 70572164 nonsense probably null
R7885:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7886:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7889:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7891:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7915:Sltm UTSW 9 70587149 missense probably damaging 1.00
R8030:Sltm UTSW 9 70585979 nonsense probably null
R8062:Sltm UTSW 9 70573497 missense unknown
R8099:Sltm UTSW 9 70586078 missense probably damaging 1.00
R8374:Sltm UTSW 9 70561945 missense probably null
R8698:Sltm UTSW 9 70587070 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CAGTAATGAGGGCTTTTCTGGC -3'
(R):5'- TCTAGAAGGATTGGGCACAGTC -3'

Sequencing Primer
(F):5'- GCAGCCTTGCCATAATTTCC -3'
(R):5'- AAGGATTGGGCACAGTCTCTCG -3'
Posted On2019-12-20