Incidental Mutation 'R7888:Itgb2'
ID609164
Institutional Source Beutler Lab
Gene Symbol Itgb2
Ensembl Gene ENSMUSG00000000290
Gene Nameintegrin beta 2
SynonymsMac-1 beta, Cd18, 2E6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R7888 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location77530252-77565708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77564644 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 697 (V697A)
Ref Sequence ENSEMBL: ENSMUSP00000000299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000299] [ENSMUST00000153541] [ENSMUST00000156644]
Predicted Effect probably benign
Transcript: ENSMUST00000000299
AA Change: V697A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000000299
Gene: ENSMUSG00000000290
AA Change: V697A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
internal_repeat_1 459 509 7.99e-5 PROSPERO
EGF_like 535 574 6.81e1 SMART
Integrin_B_tail 622 701 5.53e-22 SMART
transmembrane domain 702 724 N/A INTRINSIC
Integrin_b_cyt 725 770 1.58e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153541
SMART Domains Protein: ENSMUSP00000137734
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156644
SMART Domains Protein: ENSMUSP00000137865
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:2P28|A 23 49 9e-12 PDB
Blast:PSI 24 49 2e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for targeted null and hypomorphic mutations are subject to granulocytosis, impaired inflammatory and immune responses, and chronic dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 G T 14: 8,246,415 Q459K probably benign Het
Ano3 T A 2: 110,666,428 Y792F probably damaging Het
Aoc3 C T 11: 101,332,497 H520Y probably damaging Het
Atp4b A G 8: 13,389,811 F137S probably damaging Het
Blvrb A G 7: 27,465,734 T160A probably damaging Het
Brd2 G A 17: 34,117,021 R73W probably damaging Het
Btaf1 A G 19: 36,965,636 T306A probably benign Het
Ccdc154 G A 17: 25,164,604 V212M possibly damaging Het
Ccdc40 A G 11: 119,229,141 E3G unknown Het
Cenpb T A 2: 131,179,842 E12V probably damaging Het
Cnot8 T C 11: 58,111,311 S57P probably benign Het
Cryba4 T C 5: 112,251,052 E42G probably benign Het
Fam129b T A 2: 32,922,125 Y406* probably null Het
Fam72a T A 1: 131,528,840 I47N probably damaging Het
Gm27027 A C 2: 93,957,535 probably null Het
Jakmip1 A G 5: 37,104,864 N336D probably damaging Het
Kansl1 T C 11: 104,342,422 T760A probably benign Het
Lrrc37a T A 11: 103,501,481 E1039D probably benign Het
Meaf6 T G 4: 125,109,420 probably null Het
Mpz T C 1: 171,159,635 probably null Het
Mtss1 A T 15: 58,972,524 M82K probably damaging Het
Myo6 T C 9: 80,296,665 S1063P probably damaging Het
Nsun6 T A 2: 14,996,544 E400D probably benign Het
Olfr1057 C A 2: 86,374,926 C162F probably benign Het
Olfr121 A T 17: 37,751,997 N48Y probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr221 A G 14: 52,035,890 S74P probably damaging Het
Olfr364-ps1 A T 2: 37,146,322 M37L probably benign Het
Olfr385 T C 11: 73,589,528 D70G probably damaging Het
Olfr608 T A 7: 103,470,799 Y253* probably null Het
Pfdn5 T A 15: 102,328,589 V92E probably damaging Het
Pik3c2g T C 6: 139,896,744 V801A Het
Psme2b T A 11: 48,945,575 T182S possibly damaging Het
Ptcd3 G A 6: 71,883,447 A592V probably damaging Het
Rabgap1 T A 2: 37,537,307 Y633* probably null Het
Rnf39 A T 17: 36,947,241 T222S probably damaging Het
Scnn1g A G 7: 121,743,655 N277S probably damaging Het
Slc16a13 T G 11: 70,218,980 I232L possibly damaging Het
Slco2b1 T G 7: 99,688,843 R111S unknown Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tmc3 T C 7: 83,600,009 W269R probably damaging Het
Vmn2r4 T C 3: 64,406,522 E346G probably damaging Het
Vps52 A G 17: 33,965,751 N666S probably damaging Het
Wdfy4 C T 14: 33,090,963 D1618N Het
Zfp773 C A 7: 7,132,979 C206F probably benign Het
Other mutations in Itgb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Itgb2 APN 10 77557406 missense probably damaging 1.00
IGL00427:Itgb2 APN 10 77557956 missense probably benign 0.13
IGL00500:Itgb2 APN 10 77564724 missense probably damaging 1.00
IGL01019:Itgb2 APN 10 77542403 missense possibly damaging 0.94
IGL01104:Itgb2 APN 10 77547194 splice site probably null
IGL01111:Itgb2 APN 10 77542000 missense probably damaging 0.98
IGL01574:Itgb2 APN 10 77557964 missense possibly damaging 0.82
IGL02087:Itgb2 APN 10 77559696 missense possibly damaging 0.94
IGL02132:Itgb2 APN 10 77550061 missense probably damaging 1.00
IGL02325:Itgb2 APN 10 77547192 missense probably damaging 1.00
IGL02505:Itgb2 APN 10 77547218 missense probably damaging 1.00
IGL02590:Itgb2 APN 10 77559513 missense probably damaging 1.00
IGL02735:Itgb2 APN 10 77549999 missense possibly damaging 0.81
barely UTSW 10 77548536 splice site probably benign
fresh UTSW 10 77556161 missense probably damaging 0.98
joker UTSW 10 77549849 intron probably benign
newhome UTSW 10 77559681 missense probably benign 0.00
nibbler UTSW 10 77561216 critical splice donor site probably null
Only_just UTSW 10 77549968 missense possibly damaging 0.80
R0217:Itgb2 UTSW 10 77548536 splice site probably benign
R0394:Itgb2 UTSW 10 77542475 missense probably damaging 1.00
R0396:Itgb2 UTSW 10 77561189 missense probably damaging 0.97
R1425:Itgb2 UTSW 10 77547296 missense probably null 1.00
R1499:Itgb2 UTSW 10 77546153 missense possibly damaging 0.62
R1542:Itgb2 UTSW 10 77559486 missense probably benign
R1803:Itgb2 UTSW 10 77564790 missense probably benign 0.15
R1889:Itgb2 UTSW 10 77548623 missense possibly damaging 0.74
R2035:Itgb2 UTSW 10 77547199 missense probably damaging 1.00
R2156:Itgb2 UTSW 10 77560248 missense probably benign 0.01
R2374:Itgb2 UTSW 10 77559681 missense probably benign 0.00
R3769:Itgb2 UTSW 10 77549968 missense possibly damaging 0.80
R3942:Itgb2 UTSW 10 77558033 missense probably benign 0.31
R4352:Itgb2 UTSW 10 77556167 missense probably benign 0.10
R4537:Itgb2 UTSW 10 77561216 critical splice donor site probably null
R4600:Itgb2 UTSW 10 77546115 missense probably benign
R4611:Itgb2 UTSW 10 77550050 missense probably damaging 1.00
R4685:Itgb2 UTSW 10 77550103 critical splice donor site probably null
R4717:Itgb2 UTSW 10 77546044 nonsense probably null
R5068:Itgb2 UTSW 10 77548761 missense probably damaging 1.00
R5297:Itgb2 UTSW 10 77564667 missense probably damaging 1.00
R5355:Itgb2 UTSW 10 77558052 missense probably benign
R5927:Itgb2 UTSW 10 77546034 missense probably damaging 1.00
R6371:Itgb2 UTSW 10 77548597 missense probably damaging 1.00
R6505:Itgb2 UTSW 10 77559673 missense probably damaging 1.00
R7305:Itgb2 UTSW 10 77548564 missense probably damaging 1.00
R7574:Itgb2 UTSW 10 77560158 missense probably benign 0.18
R7606:Itgb2 UTSW 10 77556161 missense probably damaging 0.98
R7772:Itgb2 UTSW 10 77561112 missense probably benign
Z1176:Itgb2 UTSW 10 77557962 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGATGCTGTCATTTCAACCAAGG -3'
(R):5'- AAGGGTTCCCAAAGCAAGGC -3'

Sequencing Primer
(F):5'- ATGCTGTCATTTCAACCAAGGTTTCC -3'
(R):5'- GCAAGGCCACTCACATTGTTC -3'
Posted On2019-12-20