Incidental Mutation 'R0134:Nanos3'
ID60917
Institutional Source Beutler Lab
Gene Symbol Nanos3
Ensembl Gene ENSMUSG00000056155
Gene Namenanos C2HC-type zinc finger 3
Synonymsnos3
MMRRC Submission 038419-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R0134 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84173731-84185217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84176134 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 133 (R133Q)
Ref Sequence ENSEMBL: ENSMUSP00000147775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070102] [ENSMUST00000093375] [ENSMUST00000118856] [ENSMUST00000210202]
Predicted Effect probably damaging
Transcript: ENSMUST00000070102
AA Change: R133Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067385
Gene: ENSMUSG00000056155
AA Change: R133Q

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
Pfam:zf-nanos 57 110 1.2e-28 PFAM
low complexity region 157 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083549
Predicted Effect probably benign
Transcript: ENSMUST00000093375
SMART Domains Protein: ENSMUSP00000091067
Gene: ENSMUSG00000008129

DomainStartEndE-ValueType
low complexity region 226 241 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102383
Predicted Effect probably benign
Transcript: ENSMUST00000118856
SMART Domains Protein: ENSMUSP00000113651
Gene: ENSMUSG00000008129

DomainStartEndE-ValueType
Pfam:DUF4671 1 193 2.1e-62 PFAM
Pfam:DUF4671 181 600 7.3e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210202
AA Change: R133Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211482
Meta Mutation Damage Score 0.1597 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this locus results in both male and female infertility. Both male and female gonads are reduced in size and are devoid of germ cells, putatively due to impaired maintainence of primordial germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Nanos3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0047:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0048:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0089:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0090:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0102:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0103:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0145:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0189:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0190:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0226:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0344:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
R0494:Nanos3 UTSW 8 84176134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGTGGCAAACAGACATGAAATG -3'
(R):5'- TGCAAACACAATGGCGAGTCCC -3'

Sequencing Primer
(F):5'- TCTCTACTACCCTGTGCAATAAAGG -3'
(R):5'- TCCCATGTCCTGAAGGATGAG -3'
Posted On2013-07-24