Incidental Mutation 'R7888:Lrrc37a'
ID609171
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Nameleucine rich repeat containing 37A
SynonymsLOC237954
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R7888 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location103451955-103504597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103501481 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1039 (E1039D)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
Predicted Effect probably benign
Transcript: ENSMUST00000153273
AA Change: E1039D

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: E1039D

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 G T 14: 8,246,415 Q459K probably benign Het
Ano3 T A 2: 110,666,428 Y792F probably damaging Het
Aoc3 C T 11: 101,332,497 H520Y probably damaging Het
Atp4b A G 8: 13,389,811 F137S probably damaging Het
Blvrb A G 7: 27,465,734 T160A probably damaging Het
Brd2 G A 17: 34,117,021 R73W probably damaging Het
Btaf1 A G 19: 36,965,636 T306A probably benign Het
Ccdc154 G A 17: 25,164,604 V212M possibly damaging Het
Ccdc40 A G 11: 119,229,141 E3G unknown Het
Cenpb T A 2: 131,179,842 E12V probably damaging Het
Cnot8 T C 11: 58,111,311 S57P probably benign Het
Cryba4 T C 5: 112,251,052 E42G probably benign Het
Fam129b T A 2: 32,922,125 Y406* probably null Het
Fam72a T A 1: 131,528,840 I47N probably damaging Het
Gm27027 A C 2: 93,957,535 probably null Het
Itgb2 T C 10: 77,564,644 V697A probably benign Het
Jakmip1 A G 5: 37,104,864 N336D probably damaging Het
Kansl1 T C 11: 104,342,422 T760A probably benign Het
Meaf6 T G 4: 125,109,420 probably null Het
Mpz T C 1: 171,159,635 probably null Het
Mtss1 A T 15: 58,972,524 M82K probably damaging Het
Myo6 T C 9: 80,296,665 S1063P probably damaging Het
Nsun6 T A 2: 14,996,544 E400D probably benign Het
Olfr1057 C A 2: 86,374,926 C162F probably benign Het
Olfr121 A T 17: 37,751,997 N48Y probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr221 A G 14: 52,035,890 S74P probably damaging Het
Olfr364-ps1 A T 2: 37,146,322 M37L probably benign Het
Olfr385 T C 11: 73,589,528 D70G probably damaging Het
Olfr608 T A 7: 103,470,799 Y253* probably null Het
Pfdn5 T A 15: 102,328,589 V92E probably damaging Het
Pik3c2g T C 6: 139,896,744 V801A Het
Psme2b T A 11: 48,945,575 T182S possibly damaging Het
Ptcd3 G A 6: 71,883,447 A592V probably damaging Het
Rabgap1 T A 2: 37,537,307 Y633* probably null Het
Rnf39 A T 17: 36,947,241 T222S probably damaging Het
Scnn1g A G 7: 121,743,655 N277S probably damaging Het
Slc16a13 T G 11: 70,218,980 I232L possibly damaging Het
Slco2b1 T G 7: 99,688,843 R111S unknown Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tmc3 T C 7: 83,600,009 W269R probably damaging Het
Vmn2r4 T C 3: 64,406,522 E346G probably damaging Het
Vps52 A G 17: 33,965,751 N666S probably damaging Het
Wdfy4 C T 14: 33,090,963 D1618N Het
Zfp773 C A 7: 7,132,979 C206F probably benign Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103500351 missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103497937 missense unknown
IGL01352:Lrrc37a APN 11 103499355 missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103498755 missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103503861 missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103504264 missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103498419 missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103456491 missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103504539 missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103497609 missense unknown
IGL02218:Lrrc37a APN 11 103500381 missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103498177 missense unknown
IGL02487:Lrrc37a APN 11 103496037 missense unknown
IGL02597:Lrrc37a APN 11 103504287 missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103499112 missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103501306 missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103491174 missense unknown
IGL02987:Lrrc37a APN 11 103500413 missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103456595 missense unknown
IGL03210:Lrrc37a APN 11 103499505 missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103499407 missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103497673 missense unknown
IGL03296:Lrrc37a APN 11 103497673 missense unknown
IGL03299:Lrrc37a APN 11 103497673 missense unknown
IGL03370:Lrrc37a APN 11 103497673 missense unknown
IGL03390:Lrrc37a APN 11 103496031 missense unknown
F5770:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103503132 missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103504512 missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103500913 missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103499790 missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103464395 missense unknown
R0418:Lrrc37a UTSW 11 103503438 missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103503025 missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103497631 missense unknown
R1581:Lrrc37a UTSW 11 103457017 nonsense probably null
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103457156 missense unknown
R1982:Lrrc37a UTSW 11 103498966 missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103501125 missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103497822 missense unknown
R2190:Lrrc37a UTSW 11 103500043 missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103497864 missense unknown
R2899:Lrrc37a UTSW 11 103497864 missense unknown
R3439:Lrrc37a UTSW 11 103497864 missense unknown
R3899:Lrrc37a UTSW 11 103497546 missense unknown
R3916:Lrrc37a UTSW 11 103455518 missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103501470 missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103457604 missense unknown
R4043:Lrrc37a UTSW 11 103498653 missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103497982 missense unknown
R4237:Lrrc37a UTSW 11 103502289 missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103464354 critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103501798 missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103498969 missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103504537 missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103504104 missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103455480 missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103504309 missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103497612 missense unknown
R4983:Lrrc37a UTSW 11 103497618 missense unknown
R4989:Lrrc37a UTSW 11 103456739 missense unknown
R5046:Lrrc37a UTSW 11 103498240 missense unknown
R5217:Lrrc37a UTSW 11 103456954 missense unknown
R5300:Lrrc37a UTSW 11 103456958 missense unknown
R5509:Lrrc37a UTSW 11 103500535 missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103498177 missense unknown
R5655:Lrrc37a UTSW 11 103498555 missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103500175 missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103458097 missense unknown
R5815:Lrrc37a UTSW 11 103503786 missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103499071 missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103500958 missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103502536 missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103456596 missense unknown
R6056:Lrrc37a UTSW 11 103497658 missense unknown
R6125:Lrrc37a UTSW 11 103501560 missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103501216 missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103497633 missense unknown
R6320:Lrrc37a UTSW 11 103504051 missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103464387 missense unknown
R6375:Lrrc37a UTSW 11 103501089 missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103497535 missense unknown
R6468:Lrrc37a UTSW 11 103460840 missense unknown
R6490:Lrrc37a UTSW 11 103456660 missense unknown
R6502:Lrrc37a UTSW 11 103492179 missense unknown
R6509:Lrrc37a UTSW 11 103504414 missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103502097 missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103500123 missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103457543 missense unknown
R7081:Lrrc37a UTSW 11 103457955 missense unknown
R7083:Lrrc37a UTSW 11 103503340 missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103502856 missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103457775 missense unknown
R7265:Lrrc37a UTSW 11 103498941 missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103456746 missense unknown
R7362:Lrrc37a UTSW 11 103457509 missense unknown
R7450:Lrrc37a UTSW 11 103498326 missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103497432 missense unknown
R7487:Lrrc37a UTSW 11 103498219 missense unknown
R7535:Lrrc37a UTSW 11 103501857 missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103500952 missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103499638 missense probably benign 0.26
R7686:Lrrc37a UTSW 11 103498236 missense unknown
R7694:Lrrc37a UTSW 11 103504378 missense probably benign 0.12
R7696:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R7717:Lrrc37a UTSW 11 103504300 missense probably benign 0.01
R7736:Lrrc37a UTSW 11 103497459 missense unknown
R7841:Lrrc37a UTSW 11 103501105 missense probably benign 0.03
R7885:Lrrc37a UTSW 11 103503042 missense probably benign 0.01
R7993:Lrrc37a UTSW 11 103457961 missense unknown
R8051:Lrrc37a UTSW 11 103503126 missense possibly damaging 0.48
R8082:Lrrc37a UTSW 11 103457422 missense unknown
R8097:Lrrc37a UTSW 11 103504099 missense probably benign 0.04
R8108:Lrrc37a UTSW 11 103503057 missense probably benign 0.24
R8269:Lrrc37a UTSW 11 103497898 missense unknown
R8311:Lrrc37a UTSW 11 103503421 missense probably benign 0.05
R8403:Lrrc37a UTSW 11 103501585 missense probably benign 0.10
R8408:Lrrc37a UTSW 11 103460809 missense unknown
V7580:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103499544 missense possibly damaging 0.78
Z1176:Lrrc37a UTSW 11 103456486 missense probably damaging 1.00
Z1176:Lrrc37a UTSW 11 103499034 missense possibly damaging 0.68
Z1176:Lrrc37a UTSW 11 103501094 missense probably benign 0.09
Z1177:Lrrc37a UTSW 11 103499967 missense possibly damaging 0.46
Z1177:Lrrc37a UTSW 11 103500520 missense probably benign 0.43
Z1177:Lrrc37a UTSW 11 103500598 missense probably benign 0.20
Z1177:Lrrc37a UTSW 11 103503027 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGTTCAATGACTCTGGCAGCTG -3'
(R):5'- AACCAAGCAGTGTCCTCTATG -3'

Sequencing Primer
(F):5'- CAATGACTCTGGCAGCTGGTTTG -3'
(R):5'- GGAAGTTGAATCCCTTAAGGTTCCC -3'
Posted On2019-12-20