Incidental Mutation 'R7888:Rnf39'
ID609182
Institutional Source Beutler Lab
Gene Symbol Rnf39
Ensembl Gene ENSMUSG00000036492
Gene Namering finger protein 39
SynonymsLOC240094, LIRF, LOC386454, LOC386465
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7888 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location36942918-36947986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36947241 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 222 (T222S)
Ref Sequence ENSEMBL: ENSMUSP00000037860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040402] [ENSMUST00000040498] [ENSMUST00000173072] [ENSMUST00000173540] [ENSMUST00000174669] [ENSMUST00000174711]
Predicted Effect probably benign
Transcript: ENSMUST00000040402
SMART Domains Protein: ENSMUSP00000047202
Gene: ENSMUSG00000036398

DomainStartEndE-ValueType
Pfam:PPI_Ypi1 22 87 8.7e-26 PFAM
low complexity region 105 128 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000040498
AA Change: T222S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037860
Gene: ENSMUSG00000036492
AA Change: T222S

DomainStartEndE-ValueType
RING 20 66 3.47e-4 SMART
low complexity region 99 109 N/A INTRINSIC
PRY 159 212 6.23e-15 SMART
Blast:SPRY 213 349 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173072
SMART Domains Protein: ENSMUSP00000133710
Gene: ENSMUSG00000036492

DomainStartEndE-ValueType
RING 20 66 3.47e-4 SMART
low complexity region 99 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173540
SMART Domains Protein: ENSMUSP00000134322
Gene: ENSMUSG00000036398

DomainStartEndE-ValueType
Pfam:PPI_Ypi1 5 77 2e-24 PFAM
low complexity region 94 117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174669
AA Change: T100S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134113
Gene: ENSMUSG00000036492
AA Change: T100S

DomainStartEndE-ValueType
PRY 37 90 6.23e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174711
SMART Domains Protein: ENSMUSP00000134685
Gene: ENSMUSG00000036398

DomainStartEndE-ValueType
Pfam:PPI_Ypi1 22 87 8.7e-26 PFAM
low complexity region 105 128 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene lies within the major histocompatibility complex class I region on chromosome 6. Studies of a similar rat protein suggest that this gene encodes a protein that plays a role in an early phase of synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 G T 14: 8,246,415 Q459K probably benign Het
Ano3 T A 2: 110,666,428 Y792F probably damaging Het
Aoc3 C T 11: 101,332,497 H520Y probably damaging Het
Atp4b A G 8: 13,389,811 F137S probably damaging Het
Blvrb A G 7: 27,465,734 T160A probably damaging Het
Brd2 G A 17: 34,117,021 R73W probably damaging Het
Btaf1 A G 19: 36,965,636 T306A probably benign Het
Ccdc154 G A 17: 25,164,604 V212M possibly damaging Het
Ccdc40 A G 11: 119,229,141 E3G unknown Het
Cenpb T A 2: 131,179,842 E12V probably damaging Het
Cnot8 T C 11: 58,111,311 S57P probably benign Het
Cryba4 T C 5: 112,251,052 E42G probably benign Het
Fam129b T A 2: 32,922,125 Y406* probably null Het
Fam72a T A 1: 131,528,840 I47N probably damaging Het
Gm27027 A C 2: 93,957,535 probably null Het
Itgb2 T C 10: 77,564,644 V697A probably benign Het
Jakmip1 A G 5: 37,104,864 N336D probably damaging Het
Kansl1 T C 11: 104,342,422 T760A probably benign Het
Lrrc37a T A 11: 103,501,481 E1039D probably benign Het
Meaf6 T G 4: 125,109,420 probably null Het
Mpz T C 1: 171,159,635 probably null Het
Mtss1 A T 15: 58,972,524 M82K probably damaging Het
Myo6 T C 9: 80,296,665 S1063P probably damaging Het
Nsun6 T A 2: 14,996,544 E400D probably benign Het
Olfr1057 C A 2: 86,374,926 C162F probably benign Het
Olfr121 A T 17: 37,751,997 N48Y probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr221 A G 14: 52,035,890 S74P probably damaging Het
Olfr364-ps1 A T 2: 37,146,322 M37L probably benign Het
Olfr385 T C 11: 73,589,528 D70G probably damaging Het
Olfr608 T A 7: 103,470,799 Y253* probably null Het
Pfdn5 T A 15: 102,328,589 V92E probably damaging Het
Pik3c2g T C 6: 139,896,744 V801A Het
Psme2b T A 11: 48,945,575 T182S possibly damaging Het
Ptcd3 G A 6: 71,883,447 A592V probably damaging Het
Rabgap1 T A 2: 37,537,307 Y633* probably null Het
Scnn1g A G 7: 121,743,655 N277S probably damaging Het
Slc16a13 T G 11: 70,218,980 I232L possibly damaging Het
Slco2b1 T G 7: 99,688,843 R111S unknown Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tmc3 T C 7: 83,600,009 W269R probably damaging Het
Vmn2r4 T C 3: 64,406,522 E346G probably damaging Het
Vps52 A G 17: 33,965,751 N666S probably damaging Het
Wdfy4 C T 14: 33,090,963 D1618N Het
Zfp773 C A 7: 7,132,979 C206F probably benign Het
Other mutations in Rnf39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Rnf39 APN 17 36945436 missense possibly damaging 0.84
IGL02852:Rnf39 APN 17 36945202 unclassified probably benign
R3771:Rnf39 UTSW 17 36947229 missense probably damaging 1.00
R3967:Rnf39 UTSW 17 36943143 missense probably damaging 1.00
R5026:Rnf39 UTSW 17 36945534 missense probably benign 0.18
R5294:Rnf39 UTSW 17 36947200 missense probably damaging 1.00
R6139:Rnf39 UTSW 17 36943338 missense probably damaging 1.00
R6699:Rnf39 UTSW 17 36947229 missense probably damaging 1.00
R7396:Rnf39 UTSW 17 36947079 missense probably damaging 0.98
R7436:Rnf39 UTSW 17 36943349 missense probably benign 0.39
R7536:Rnf39 UTSW 17 36943117 missense probably damaging 1.00
R8164:Rnf39 UTSW 17 36943400 missense probably damaging 0.98
X0067:Rnf39 UTSW 17 36943266 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTTCTGCAGCTGACCTGAC -3'
(R):5'- AGTCCAAGTCCACGCGAATG -3'

Sequencing Primer
(F):5'- AGCTGACCTGACGCTCGAC -3'
(R):5'- TGGCACCACCTAGCAGG -3'
Posted On2019-12-20