Incidental Mutation 'R7889:Hdc'
ID 609196
Institutional Source Beutler Lab
Gene Symbol Hdc
Ensembl Gene ENSMUSG00000027360
Gene Name histidine decarboxylase
Synonyms Hdc-s, Hdc-a, Hdc-c, Hdc-e, L-histidine decarboxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock # R7889 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 126593667-126619299 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 126616210 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 64 (I64N)
Ref Sequence ENSEMBL: ENSMUSP00000028838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028838]
AlphaFold P23738
Predicted Effect probably damaging
Transcript: ENSMUST00000028838
AA Change: I64N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028838
Gene: ENSMUSG00000027360
AA Change: I64N

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Pyridoxal_deC 43 421 2.2e-173 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group II decarboxylase family and forms a homodimer that converts L-histidine to histamine in a pyridoxal phosphate dependent manner. Histamine regulates several physiologic processes, including neurotransmission, gastric acid secretion,inflamation, and smooth muscle tone.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mast cells, altered anxiety-related and nociceptive behavior, altered cognitive function, increased weight gain, visceral adiposity, increased amount of brown adipose tissue, impaired glucose tolerance, hyperinsulinemia, and hyperleptinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 C T 4: 99,031,071 L23F probably benign Het
Art2a-ps C T 7: 101,555,211 S40N not run Het
Ash1l A G 3: 88,966,038 T43A probably benign Het
Atp1a2 G A 1: 172,278,064 probably null Het
Azi2 A G 9: 118,061,915 E336G probably benign Het
Cap2 A G 13: 46,646,575 H419R probably damaging Het
Ccdc14 T A 16: 34,723,836 S903T probably damaging Het
Cep72 A T 13: 74,050,122 S380T possibly damaging Het
Clca3a2 C A 3: 144,810,813 E341* probably null Het
Clcnkb T G 4: 141,410,604 I294L probably benign Het
Cyp2d9 T A 15: 82,455,826 M350K probably damaging Het
Dhx40 T G 11: 86,798,967 I266L probably benign Het
Dnah5 G T 15: 28,448,414 E4208* probably null Het
Ephb2 T C 4: 136,771,042 N242S probably damaging Het
Fam13b A T 18: 34,457,691 F478Y probably benign Het
Fastkd2 C G 1: 63,735,460 probably null Het
Fbxo40 T A 16: 36,969,650 D366V probably damaging Het
Fhod3 A T 18: 24,770,494 K95M probably damaging Het
Foxo3 T A 10: 42,275,027 Q136L probably benign Het
Gadl1 A T 9: 115,954,815 Q236L possibly damaging Het
Galnt13 A G 2: 55,112,861 D560G probably benign Het
Ghsr A G 3: 27,372,166 S124G probably benign Het
Gkn2 A G 6: 87,378,286 probably null Het
Glyctk T A 9: 106,156,439 R68W unknown Het
Gm10031 G A 1: 156,525,395 A389T probably benign Het
Gm14025 T C 2: 129,036,994 E1004G unknown Het
Gm5157 G A 7: 21,184,716 P301S unknown Het
Helq A T 5: 100,792,561 probably null Het
Ighv1-43 T C 12: 114,945,963 Y113C probably damaging Het
Ipo9 T C 1: 135,406,853 T273A probably benign Het
Itga4 G A 2: 79,316,045 V774I probably benign Het
Itpr3 T C 17: 27,116,777 L2287P probably damaging Het
Llgl1 T A 11: 60,707,312 I394N probably damaging Het
Mta1 G A 12: 113,131,688 R487H probably benign Het
Neb T C 2: 52,147,669 D7049G probably benign Het
Nlrp4f G A 13: 65,195,018 S271F probably damaging Het
Noxo1 A G 17: 24,699,382 D172G probably damaging Het
Nup155 T A 15: 8,121,507 V347E probably damaging Het
Oaf G T 9: 43,222,671 A251E possibly damaging Het
Pds5b T A 5: 150,792,172 F1039I probably damaging Het
Pla2g12b T A 10: 59,421,240 probably null Het
Prmt3 A G 7: 49,787,301 D208G possibly damaging Het
Ptcd3 G A 6: 71,888,608 T441M probably damaging Het
Rabl6 A G 2: 25,584,774 probably null Het
Shtn1 T A 19: 59,003,896 I417F probably damaging Het
Slc20a2 T C 8: 22,540,401 S158P probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Spata5 A G 3: 37,578,810 D855G probably benign Het
Spef2 T C 15: 9,717,563 Y232C probably damaging Het
Stard9 C T 2: 120,704,461 T3733I probably benign Het
Thrap3 A T 4: 126,178,062 F512L probably benign Het
Tmem150c A T 5: 100,093,104 I30K probably damaging Het
Tnnt1 C T 7: 4,508,583 A168T probably damaging Het
Trak2 A G 1: 58,918,824 L308P probably damaging Het
Trp53i11 T C 2: 93,198,899 L81P probably damaging Het
Usp16 T C 16: 87,474,584 Y344H probably benign Het
Wdr60 T A 12: 116,255,939 K128* probably null Het
Xrcc5 G T 1: 72,356,826 V593L probably benign Het
Zcchc14 A T 8: 121,604,895 H576Q unknown Het
Zfp616 T A 11: 74,085,445 C847S probably damaging Het
Zfp626 A T 7: 27,819,499 Y635F probably benign Het
Zfp799 G A 17: 32,819,499 R598* probably null Het
Zfp831 A G 2: 174,645,304 K591E possibly damaging Het
Other mutations in Hdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Hdc APN 2 126601872 missense probably benign 0.00
IGL01024:Hdc APN 2 126603846 missense probably benign 0.32
IGL01393:Hdc APN 2 126594661 missense probably benign 0.28
IGL01802:Hdc APN 2 126603894 missense probably benign 0.04
IGL01958:Hdc APN 2 126594532 missense possibly damaging 0.87
IGL02193:Hdc APN 2 126601780 splice site probably benign
IGL02494:Hdc APN 2 126594121 missense probably benign
IGL02696:Hdc APN 2 126594300 missense probably damaging 1.00
IGL02874:Hdc APN 2 126601676 missense probably benign 0.21
R0453:Hdc UTSW 2 126594951 splice site probably benign
R0528:Hdc UTSW 2 126616232 missense probably benign 0.00
R1337:Hdc UTSW 2 126616276 missense probably benign
R1862:Hdc UTSW 2 126597933 missense probably benign 0.36
R1938:Hdc UTSW 2 126606397 missense possibly damaging 0.86
R1994:Hdc UTSW 2 126616187 missense probably damaging 1.00
R2230:Hdc UTSW 2 126594018 missense possibly damaging 0.65
R2257:Hdc UTSW 2 126616080 splice site probably null
R2921:Hdc UTSW 2 126593990 missense probably damaging 1.00
R2923:Hdc UTSW 2 126593990 missense probably damaging 1.00
R3620:Hdc UTSW 2 126616267 missense possibly damaging 0.86
R3621:Hdc UTSW 2 126616267 missense possibly damaging 0.86
R3914:Hdc UTSW 2 126603006 missense probably damaging 1.00
R4076:Hdc UTSW 2 126616261 missense possibly damaging 0.92
R4114:Hdc UTSW 2 126601818 missense probably benign 0.16
R4213:Hdc UTSW 2 126597866 splice site probably null
R4827:Hdc UTSW 2 126594313 missense probably benign
R4889:Hdc UTSW 2 126594133 missense probably benign 0.00
R5013:Hdc UTSW 2 126604300 missense probably benign 0.33
R5593:Hdc UTSW 2 126618584 utr 5 prime probably benign
R5604:Hdc UTSW 2 126594663 missense probably benign
R5637:Hdc UTSW 2 126616189 missense probably benign 0.02
R6211:Hdc UTSW 2 126593977 missense probably damaging 0.98
R6312:Hdc UTSW 2 126607406 missense possibly damaging 0.65
R7730:Hdc UTSW 2 126594082 missense possibly damaging 0.51
R8328:Hdc UTSW 2 126601883 missense probably damaging 1.00
R8482:Hdc UTSW 2 126594205 missense probably benign
R8517:Hdc UTSW 2 126597970 critical splice acceptor site probably null
R9136:Hdc UTSW 2 126597866 splice site probably null
R9139:Hdc UTSW 2 126597917 missense probably damaging 1.00
R9208:Hdc UTSW 2 126594680 missense probably benign 0.32
R9515:Hdc UTSW 2 126616229 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCACTACAGGTCAGCACTG -3'
(R):5'- AAGGAAATGTGACCCGGTTC -3'

Sequencing Primer
(F):5'- TACAGGTCAGCACTGGCACAAG -3'
(R):5'- GAAATGTGACCCGGTTCCTCTG -3'
Posted On 2019-12-20