Incidental Mutation 'R7889:Clca3a2'
ID609202
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Namechloride channel accessory 3A2
SynonymsClca2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R7889 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location144796559-144819494 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 144810813 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 341 (E341*)
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929]
Predicted Effect probably null
Transcript: ENSMUST00000029929
AA Change: E341*
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262
AA Change: E341*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197013
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 C T 4: 99,031,071 L23F probably benign Het
Art2a-ps C T 7: 101,555,211 S40N not run Het
Ash1l A G 3: 88,966,038 T43A probably benign Het
Azi2 A G 9: 118,061,915 E336G probably benign Het
Cap2 A G 13: 46,646,575 H419R probably damaging Het
Ccdc14 T A 16: 34,723,836 S903T probably damaging Het
Cep72 A T 13: 74,050,122 S380T possibly damaging Het
Clcnkb T G 4: 141,410,604 I294L probably benign Het
Cyp2d9 T A 15: 82,455,826 M350K probably damaging Het
Dhx40 T G 11: 86,798,967 I266L probably benign Het
Dnah5 G T 15: 28,448,414 E4208* probably null Het
Ephb2 T C 4: 136,771,042 N242S probably damaging Het
Fam13b A T 18: 34,457,691 F478Y probably benign Het
Fbxo40 T A 16: 36,969,650 D366V probably damaging Het
Fhod3 A T 18: 24,770,494 K95M probably damaging Het
Foxo3 T A 10: 42,275,027 Q136L probably benign Het
Gadl1 A T 9: 115,954,815 Q236L possibly damaging Het
Galnt13 A G 2: 55,112,861 D560G probably benign Het
Ghsr A G 3: 27,372,166 S124G probably benign Het
Glyctk T A 9: 106,156,439 R68W unknown Het
Gm10031 G A 1: 156,525,395 A389T probably benign Het
Gm14025 T C 2: 129,036,994 E1004G unknown Het
Gm5157 G A 7: 21,184,716 P301S unknown Het
Hdc A T 2: 126,616,210 I64N probably damaging Het
Ighv1-43 T C 12: 114,945,963 Y113C probably damaging Het
Ipo9 T C 1: 135,406,853 T273A probably benign Het
Itga4 G A 2: 79,316,045 V774I probably benign Het
Itpr3 T C 17: 27,116,777 L2287P probably damaging Het
Llgl1 T A 11: 60,707,312 I394N probably damaging Het
Mta1 G A 12: 113,131,688 R487H probably benign Het
Neb T C 2: 52,147,669 D7049G probably benign Het
Nlrp4f G A 13: 65,195,018 S271F probably damaging Het
Noxo1 A G 17: 24,699,382 D172G probably damaging Het
Nup155 T A 15: 8,121,507 V347E probably damaging Het
Oaf G T 9: 43,222,671 A251E possibly damaging Het
Pds5b T A 5: 150,792,172 F1039I probably damaging Het
Prmt3 A G 7: 49,787,301 D208G possibly damaging Het
Ptcd3 G A 6: 71,888,608 T441M probably damaging Het
Rabl6 A G 2: 25,584,774 probably null Het
Shtn1 T A 19: 59,003,896 I417F probably damaging Het
Slc20a2 T C 8: 22,540,401 S158P probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Spata5 A G 3: 37,578,810 D855G probably benign Het
Spef2 T C 15: 9,717,563 Y232C probably damaging Het
Stard9 C T 2: 120,704,461 T3733I probably benign Het
Thrap3 A T 4: 126,178,062 F512L probably benign Het
Tmem150c A T 5: 100,093,104 I30K probably damaging Het
Tnnt1 C T 7: 4,508,583 A168T probably damaging Het
Trak2 A G 1: 58,918,824 L308P probably damaging Het
Trp53i11 T C 2: 93,198,899 L81P probably damaging Het
Usp16 T C 16: 87,474,584 Y344H probably benign Het
Wdr60 T A 12: 116,255,939 K128* probably null Het
Xrcc5 G T 1: 72,356,826 V593L probably benign Het
Zcchc14 A T 8: 121,604,895 H576Q unknown Het
Zfp616 T A 11: 74,085,445 C847S probably damaging Het
Zfp626 A T 7: 27,819,499 Y635F probably benign Het
Zfp799 G A 17: 32,819,499 R598* probably null Het
Zfp831 A G 2: 174,645,304 K591E possibly damaging Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 unclassified probably null
R6593:Clca3a2 UTSW 3 144808577 critical splice donor site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7411:Clca3a2 UTSW 3 144802099 missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144801913 makesense probably null
R7972:Clca3a2 UTSW 3 144810813 nonsense probably null
R8022:Clca3a2 UTSW 3 144805766 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCTGAAATCCTGCCTG -3'
(R):5'- AGCATAGACTTTGAAGGTTGTCAG -3'

Sequencing Primer
(F):5'- CCTGGAGTCCATGGCAAATTG -3'
(R):5'- TGAAGGTTGTCAGAACTATAACAAC -3'
Posted On2019-12-20