Mutagenetix > Incidental Mutations

Incidental Mutation 'R7889:Ephb2'

609205

Institutional Source

Beutler Lab

Gene Symbol

Ephb2

Ensembl Gene

ENSMUSG00000028664

Gene Name

Eph receptor B2

Synonyms

Erk, eteck, Tyro5, Prkm5, Drt, Hek5, Sek3, Qek5, Cek5, Nuk

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.662) question?

Stock #

R7889 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

136647539-136835988 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 136771042 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 242 (N242S)

Ref Sequence

ENSEMBL: ENSMUSP00000101471 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059287] [ENSMUST00000105845] [ENSMUST00000105846]

Predicted Effect

probably damaging
Transcript: ENSMUST00000059287
AA Change: N242S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000058135
Gene: ENSMUSG00000028664
AA Change: N242S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EPH_lbd	20	197	7.37e-130	SMART
Pfam:GCC2_GCC3	261	304	8.1e-10	PFAM
FN3	325	417	1.75e-6	SMART
FN3	436	518	1.23e-10	SMART
Pfam:EphA2_TM	545	619	6e-25	PFAM
TyrKc	622	881	1.34e-138	SMART
SAM	911	978	1.18e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105845
AA Change: N242S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000101471
Gene: ENSMUSG00000028664
AA Change: N242S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EPH_lbd	20	197	7.37e-130	SMART
Pfam:GCC2_GCC3	259	305	2.2e-10	PFAM
FN3	325	417	1.75e-6	SMART
FN3	436	517	1.41e-10	SMART
Pfam:EphA2_TM	543	618	2.1e-30	PFAM
TyrKc	621	880	1.34e-138	SMART
SAM	910	977	1.18e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105846
AA Change: N242S

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000101472
Gene: ENSMUSG00000028664
AA Change: N242S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EPH_lbd	20	197	7.37e-130	SMART
Pfam:GCC2_GCC3	259	305	2.2e-10	PFAM
FN3	325	417	1.75e-6	SMART
FN3	436	517	1.41e-10	SMART
Pfam:EphA2_TM	543	619	1e-30	PFAM
TyrKc	622	881	1.34e-138	SMART
SAM	911	978	1.18e-23	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: This gene encodes a member of the Eph receptor family of receptor tyrosine kinase transmembrane glycoproteins. These receptors consist of an N-terminal glycosylated ligand-binding domain, a transmembrane region and an intracellular kinase domain. The encoded receptor preferentially binds membrane-bound ephrin-B ligands and is involved in nervous system and vascular development. This gene is used as a marker of intestinal stem cells. Homozygous knockout mice for this gene exhibit impaired axon guidance and vestibular function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal axon guidance, circling, head bobbing, and hyperactivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Angptl3	C	T	4: 99,031,071	L23F	probably benign	Het
Art2a-ps	C	T	7: 101,555,211	S40N	not run	Het
Ash1l	A	G	3: 88,966,038	T43A	probably benign	Het
Atp1a2	G	A	1: 172,278,064		probably null	Het
Azi2	A	G	9: 118,061,915	E336G	probably benign	Het
Cap2	A	G	13: 46,646,575	H419R	probably damaging	Het
Ccdc14	T	A	16: 34,723,836	S903T	probably damaging	Het
Cep72	A	T	13: 74,050,122	S380T	possibly damaging	Het
Clca3a2	C	A	3: 144,810,813	E341*	probably null	Het
Clcnkb	T	G	4: 141,410,604	I294L	probably benign	Het
Cyp2d9	T	A	15: 82,455,826	M350K	probably damaging	Het
Dhx40	T	G	11: 86,798,967	I266L	probably benign	Het
Dnah5	G	T	15: 28,448,414	E4208*	probably null	Het
Fam13b	A	T	18: 34,457,691	F478Y	probably benign	Het
Fastkd2	C	G	1: 63,735,460		probably null	Het
Fbxo40	T	A	16: 36,969,650	D366V	probably damaging	Het
Fhod3	A	T	18: 24,770,494	K95M	probably damaging	Het
Foxo3	T	A	10: 42,275,027	Q136L	probably benign	Het
Gadl1	A	T	9: 115,954,815	Q236L	possibly damaging	Het
Galnt13	A	G	2: 55,112,861	D560G	probably benign	Het
Ghsr	A	G	3: 27,372,166	S124G	probably benign	Het
Gkn2	A	G	6: 87,378,286		probably null	Het
Glyctk	T	A	9: 106,156,439	R68W	unknown	Het
Gm10031	G	A	1: 156,525,395	A389T	probably benign	Het
Gm14025	T	C	2: 129,036,994	E1004G	unknown	Het
Gm5157	G	A	7: 21,184,716	P301S	unknown	Het
Hdc	A	T	2: 126,616,210	I64N	probably damaging	Het
Helq	A	T	5: 100,792,561		probably null	Het
Ighv1-43	T	C	12: 114,945,963	Y113C	probably damaging	Het
Ipo9	T	C	1: 135,406,853	T273A	probably benign	Het
Itga4	G	A	2: 79,316,045	V774I	probably benign	Het
Itpr3	T	C	17: 27,116,777	L2287P	probably damaging	Het
Llgl1	T	A	11: 60,707,312	I394N	probably damaging	Het
Mta1	G	A	12: 113,131,688	R487H	probably benign	Het
Neb	T	C	2: 52,147,669	D7049G	probably benign	Het
Nlrp4f	G	A	13: 65,195,018	S271F	probably damaging	Het
Noxo1	A	G	17: 24,699,382	D172G	probably damaging	Het
Nup155	T	A	15: 8,121,507	V347E	probably damaging	Het
Oaf	G	T	9: 43,222,671	A251E	possibly damaging	Het
Pds5b	T	A	5: 150,792,172	F1039I	probably damaging	Het
Pla2g12b	T	A	10: 59,421,240		probably null	Het
Prmt3	A	G	7: 49,787,301	D208G	possibly damaging	Het
Ptcd3	G	A	6: 71,888,608	T441M	probably damaging	Het
Rabl6	A	G	2: 25,584,774		probably null	Het
Shtn1	T	A	19: 59,003,896	I417F	probably damaging	Het
Slc20a2	T	C	8: 22,540,401	S158P	probably damaging	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Spata5	A	G	3: 37,578,810	D855G	probably benign	Het
Spef2	T	C	15: 9,717,563	Y232C	probably damaging	Het
Stard9	C	T	2: 120,704,461	T3733I	probably benign	Het
Thrap3	A	T	4: 126,178,062	F512L	probably benign	Het
Tmem150c	A	T	5: 100,093,104	I30K	probably damaging	Het
Tnnt1	C	T	7: 4,508,583	A168T	probably damaging	Het
Trak2	A	G	1: 58,918,824	L308P	probably damaging	Het
Trp53i11	T	C	2: 93,198,899	L81P	probably damaging	Het
Usp16	T	C	16: 87,474,584	Y344H	probably benign	Het
Wdr60	T	A	12: 116,255,939	K128*	probably null	Het
Xrcc5	G	T	1: 72,356,826	V593L	probably benign	Het
Zcchc14	A	T	8: 121,604,895	H576Q	unknown	Het
Zfp616	T	A	11: 74,085,445	C847S	probably damaging	Het
Zfp626	A	T	7: 27,819,499	Y635F	probably benign	Het
Zfp799	G	A	17: 32,819,499	R598*	probably null	Het
Zfp831	A	G	2: 174,645,304	K591E	possibly damaging	Het

Other mutations in Ephb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ephb2	APN	4	136657484	missense	probably damaging	0.96
IGL00963:Ephb2	APN	4	136658951	missense	probably benign	0.04
IGL01111:Ephb2	APN	4	136657410	missense	probably benign	0.01
IGL01462:Ephb2	APN	4	136771370	missense	possibly damaging	0.61
IGL01863:Ephb2	APN	4	136659777	missense	probably benign	0.03
IGL02149:Ephb2	APN	4	136693914	missense	probably damaging	1.00
IGL02232:Ephb2	APN	4	136657451	missense	probably damaging	0.97
IGL02269:Ephb2	APN	4	136771049	missense	possibly damaging	0.66
IGL02828:Ephb2	APN	4	136771150	missense	probably benign	0.09
IGL03109:Ephb2	APN	4	136771544	missense	probably damaging	1.00
IGL03284:Ephb2	APN	4	136661516	missense	probably damaging	0.96
Zimbalist	UTSW	4	136659709	missense	probably damaging	1.00
BB006:Ephb2	UTSW	4	136660884	missense	probably damaging	1.00
BB016:Ephb2	UTSW	4	136660884	missense	probably damaging	1.00
PIT4453001:Ephb2	UTSW	4	136660810	missense	probably benign	0.00
R0004:Ephb2	UTSW	4	136657524	missense	probably damaging	1.00
R0121:Ephb2	UTSW	4	136771057	missense	probably damaging	0.99
R0539:Ephb2	UTSW	4	136655976	missense	probably damaging	1.00
R0614:Ephb2	UTSW	4	136673365	missense	probably benign	0.00
R0988:Ephb2	UTSW	4	136659708	missense	possibly damaging	0.59
R1471:Ephb2	UTSW	4	136658951	missense	probably benign	0.04
R1473:Ephb2	UTSW	4	136694058	missense	possibly damaging	0.83
R1546:Ephb2	UTSW	4	136771009	missense	probably damaging	0.99
R1639:Ephb2	UTSW	4	136693905	missense	probably benign	0.10
R1725:Ephb2	UTSW	4	136659778	nonsense	probably null
R1779:Ephb2	UTSW	4	136693825	missense	possibly damaging	0.64
R1818:Ephb2	UTSW	4	136655336	missense	probably benign	0.02
R2099:Ephb2	UTSW	4	136660755	missense	probably damaging	1.00
R2916:Ephb2	UTSW	4	136683945	missense	probably damaging	0.99
R3885:Ephb2	UTSW	4	136771034	missense	probably damaging	1.00
R4572:Ephb2	UTSW	4	136655940	missense	probably damaging	1.00
R4709:Ephb2	UTSW	4	136696052	missense	probably damaging	1.00
R4893:Ephb2	UTSW	4	136659753	missense	probably damaging	0.99
R4981:Ephb2	UTSW	4	136696010	missense	probably benign	0.09
R4992:Ephb2	UTSW	4	136660839	missense	probably damaging	1.00
R5004:Ephb2	UTSW	4	136659699	missense	possibly damaging	0.77
R5307:Ephb2	UTSW	4	136693787	missense	possibly damaging	0.89
R5370:Ephb2	UTSW	4	136771570	missense	probably benign	0.00
R5561:Ephb2	UTSW	4	136661406	missense	probably damaging	1.00
R5643:Ephb2	UTSW	4	136771612	missense	probably damaging	0.99
R5826:Ephb2	UTSW	4	136660737	missense	probably damaging	1.00
R5858:Ephb2	UTSW	4	136672445	missense	probably benign
R5867:Ephb2	UTSW	4	136675422	missense	possibly damaging	0.81
R5990:Ephb2	UTSW	4	136696055	missense	probably benign	0.03
R6000:Ephb2	UTSW	4	136684030	missense	possibly damaging	0.76
R6156:Ephb2	UTSW	4	136661505	missense	probably benign	0.44
R6413:Ephb2	UTSW	4	136771122	missense	probably benign	0.08
R6577:Ephb2	UTSW	4	136657550	missense	probably damaging	0.99
R6633:Ephb2	UTSW	4	136683996	missense	probably benign	0.07
R6720:Ephb2	UTSW	4	136657502	missense	probably damaging	0.99
R6795:Ephb2	UTSW	4	136673335	missense	possibly damaging	0.88
R7235:Ephb2	UTSW	4	136693828	missense	probably damaging	1.00
R7260:Ephb2	UTSW	4	136771574	missense	probably damaging	0.96
R7328:Ephb2	UTSW	4	136658934	critical splice donor site	probably null
R7404:Ephb2	UTSW	4	136771213	missense	probably damaging	1.00
R7466:Ephb2	UTSW	4	136659065	missense	probably damaging	1.00
R7524:Ephb2	UTSW	4	136659709	missense	probably damaging	1.00
R7605:Ephb2	UTSW	4	136771108	missense	probably damaging	1.00
R7611:Ephb2	UTSW	4	136660901	critical splice acceptor site	probably null
R7777:Ephb2	UTSW	4	136771636	missense	possibly damaging	0.92
R7929:Ephb2	UTSW	4	136660884	missense	probably damaging	1.00
R8191:Ephb2	UTSW	4	136658945	missense	probably damaging	0.96
R8370:Ephb2	UTSW	4	136655991	missense	possibly damaging	0.95
R8444:Ephb2	UTSW	4	136661400	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAAACCTCCAGCCTTGTC -3'
(R):5'- TGTCCCGCAATGGTTTCTAC -3'

Sequencing Primer
(F):5'- TCCAGCCTTGTCAGTCAGAG -3'
(R):5'- ACTATGGCGGCTGTATGTCCC -3'

Posted On

2019-12-20