Incidental Mutation 'R7889:Sltm'
ID609218
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene NameSAFB-like, transcription modulator
Synonyms9130215G10Rik, 5730555F13Rik, 5730455C01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7889 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location70542754-70592234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 70586673 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 802 (P802R)
Ref Sequence ENSEMBL: ENSMUSP00000049112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000216816] [ENSMUST00000217593]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049263
AA Change: P802R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: P802R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216816
AA Change: P784R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000217593
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 C T 4: 99,031,071 L23F probably benign Het
Art2a-ps C T 7: 101,555,211 S40N not run Het
Ash1l A G 3: 88,966,038 T43A probably benign Het
Atp1a2 G A 1: 172,278,064 probably null Het
Azi2 A G 9: 118,061,915 E336G probably benign Het
Cap2 A G 13: 46,646,575 H419R probably damaging Het
Ccdc14 T A 16: 34,723,836 S903T probably damaging Het
Cep72 A T 13: 74,050,122 S380T possibly damaging Het
Clca3a2 C A 3: 144,810,813 E341* probably null Het
Clcnkb T G 4: 141,410,604 I294L probably benign Het
Cyp2d9 T A 15: 82,455,826 M350K probably damaging Het
Dhx40 T G 11: 86,798,967 I266L probably benign Het
Dnah5 G T 15: 28,448,414 E4208* probably null Het
Ephb2 T C 4: 136,771,042 N242S probably damaging Het
Fam13b A T 18: 34,457,691 F478Y probably benign Het
Fastkd2 C G 1: 63,735,460 probably null Het
Fbxo40 T A 16: 36,969,650 D366V probably damaging Het
Fhod3 A T 18: 24,770,494 K95M probably damaging Het
Foxo3 T A 10: 42,275,027 Q136L probably benign Het
Gadl1 A T 9: 115,954,815 Q236L possibly damaging Het
Galnt13 A G 2: 55,112,861 D560G probably benign Het
Ghsr A G 3: 27,372,166 S124G probably benign Het
Gkn2 A G 6: 87,378,286 probably null Het
Glyctk T A 9: 106,156,439 R68W unknown Het
Gm10031 G A 1: 156,525,395 A389T probably benign Het
Gm14025 T C 2: 129,036,994 E1004G unknown Het
Gm5157 G A 7: 21,184,716 P301S unknown Het
Hdc A T 2: 126,616,210 I64N probably damaging Het
Helq A T 5: 100,792,561 probably null Het
Ighv1-43 T C 12: 114,945,963 Y113C probably damaging Het
Ipo9 T C 1: 135,406,853 T273A probably benign Het
Itga4 G A 2: 79,316,045 V774I probably benign Het
Itpr3 T C 17: 27,116,777 L2287P probably damaging Het
Llgl1 T A 11: 60,707,312 I394N probably damaging Het
Mta1 G A 12: 113,131,688 R487H probably benign Het
Neb T C 2: 52,147,669 D7049G probably benign Het
Nlrp4f G A 13: 65,195,018 S271F probably damaging Het
Noxo1 A G 17: 24,699,382 D172G probably damaging Het
Nup155 T A 15: 8,121,507 V347E probably damaging Het
Oaf G T 9: 43,222,671 A251E possibly damaging Het
Pds5b T A 5: 150,792,172 F1039I probably damaging Het
Pla2g12b T A 10: 59,421,240 probably null Het
Prmt3 A G 7: 49,787,301 D208G possibly damaging Het
Ptcd3 G A 6: 71,888,608 T441M probably damaging Het
Rabl6 A G 2: 25,584,774 probably null Het
Shtn1 T A 19: 59,003,896 I417F probably damaging Het
Slc20a2 T C 8: 22,540,401 S158P probably damaging Het
Spata5 A G 3: 37,578,810 D855G probably benign Het
Spef2 T C 15: 9,717,563 Y232C probably damaging Het
Stard9 C T 2: 120,704,461 T3733I probably benign Het
Thrap3 A T 4: 126,178,062 F512L probably benign Het
Tmem150c A T 5: 100,093,104 I30K probably damaging Het
Tnnt1 C T 7: 4,508,583 A168T probably damaging Het
Trak2 A G 1: 58,918,824 L308P probably damaging Het
Trp53i11 T C 2: 93,198,899 L81P probably damaging Het
Usp16 T C 16: 87,474,584 Y344H probably benign Het
Wdr60 T A 12: 116,255,939 K128* probably null Het
Xrcc5 G T 1: 72,356,826 V593L probably benign Het
Zcchc14 A T 8: 121,604,895 H576Q unknown Het
Zfp616 T A 11: 74,085,445 C847S probably damaging Het
Zfp626 A T 7: 27,819,499 Y635F probably benign Het
Zfp799 G A 17: 32,819,499 R598* probably null Het
Zfp831 A G 2: 174,645,304 K591E possibly damaging Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70579342 missense probably damaging 1.00
IGL01755:Sltm APN 9 70583922 splice site probably null
IGL01782:Sltm APN 9 70573641 missense probably damaging 1.00
IGL02441:Sltm APN 9 70587185 missense probably damaging 1.00
IGL02831:Sltm APN 9 70584865 missense probably damaging 1.00
IGL02947:Sltm APN 9 70591664 missense probably benign 0.05
IGL03166:Sltm APN 9 70542969 missense possibly damaging 0.87
R0288:Sltm UTSW 9 70579351 missense probably damaging 1.00
R0555:Sltm UTSW 9 70586081 missense probably damaging 1.00
R0815:Sltm UTSW 9 70561908 missense probably benign 0.04
R0863:Sltm UTSW 9 70561908 missense probably benign 0.04
R1315:Sltm UTSW 9 70543065 missense probably benign 0.13
R1533:Sltm UTSW 9 70586666 missense probably damaging 1.00
R1676:Sltm UTSW 9 70573647 missense probably damaging 1.00
R1764:Sltm UTSW 9 70561800 missense probably benign 0.00
R1845:Sltm UTSW 9 70543032 missense possibly damaging 0.60
R2049:Sltm UTSW 9 70581301 missense probably benign 0.00
R2163:Sltm UTSW 9 70591682 missense probably damaging 0.99
R3410:Sltm UTSW 9 70585958 missense probably damaging 0.97
R4323:Sltm UTSW 9 70580247 missense probably benign
R4632:Sltm UTSW 9 70579369 missense possibly damaging 0.86
R4748:Sltm UTSW 9 70581365 missense probably damaging 1.00
R4756:Sltm UTSW 9 70591610 missense possibly damaging 0.57
R4782:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4799:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4887:Sltm UTSW 9 70588978 missense probably damaging 1.00
R5221:Sltm UTSW 9 70579403 missense probably damaging 1.00
R5263:Sltm UTSW 9 70584799 missense unknown
R5982:Sltm UTSW 9 70586804 missense probably damaging 1.00
R6297:Sltm UTSW 9 70581359 missense probably damaging 0.99
R6456:Sltm UTSW 9 70542987 missense probably damaging 1.00
R6658:Sltm UTSW 9 70581362 missense probably damaging 1.00
R6720:Sltm UTSW 9 70573710 missense probably damaging 1.00
R6770:Sltm UTSW 9 70584777 missense unknown
R6923:Sltm UTSW 9 70574610 missense probably damaging 1.00
R7051:Sltm UTSW 9 70559066 missense probably damaging 1.00
R7166:Sltm UTSW 9 70584850 missense probably damaging 1.00
R7257:Sltm UTSW 9 70543965 splice site probably null
R7400:Sltm UTSW 9 70586070 missense probably damaging 1.00
R7438:Sltm UTSW 9 70573466 missense unknown
R7484:Sltm UTSW 9 70573897 missense unknown
R7630:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7631:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7632:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7633:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7862:Sltm UTSW 9 70572164 nonsense probably null
R7885:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7886:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7888:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7891:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7915:Sltm UTSW 9 70587149 missense probably damaging 1.00
R8030:Sltm UTSW 9 70585979 nonsense probably null
R8062:Sltm UTSW 9 70573497 missense unknown
R8099:Sltm UTSW 9 70586078 missense probably damaging 1.00
R8374:Sltm UTSW 9 70561945 missense probably null
R8698:Sltm UTSW 9 70587070 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AAACCAGCCTTTGTATTAGACAGC -3'
(R):5'- ACCTCAGGTCGGTCATGAAG -3'

Sequencing Primer
(F):5'- AGCTCAATTTAAAAGAAGATCATTGC -3'
(R):5'- CCTCAGGTCGGTCATGAAGGATTAC -3'
Posted On2019-12-20