Incidental Mutation 'R7889:Gadl1'
ID609220
Institutional Source Beutler Lab
Gene Symbol Gadl1
Ensembl Gene ENSMUSG00000056880
Gene Nameglutamate decarboxylase-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7889 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location115909455-116076176 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115954815 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 236 (Q236L)
Ref Sequence ENSEMBL: ENSMUSP00000112433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069651] [ENSMUST00000119291] [ENSMUST00000121770]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069651
AA Change: Q236L

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077694
Gene: ENSMUSG00000056880
AA Change: Q236L

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 1.1e-113 PFAM
Pfam:Beta_elim_lyase 137 467 1e-7 PFAM
Pfam:Aminotran_5 167 333 1.6e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119291
AA Change: Q236L

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112433
Gene: ENSMUSG00000056880
AA Change: Q236L

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 3.2e-112 PFAM
Pfam:Beta_elim_lyase 137 446 1.6e-6 PFAM
Pfam:Aminotran_5 184 330 3.3e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121770
AA Change: Q236L

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113240
Gene: ENSMUSG00000056880
AA Change: Q236L

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 2.8e-112 PFAM
Pfam:Beta_elim_lyase 137 461 6.2e-8 PFAM
Pfam:Aminotran_5 184 330 4.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 C T 4: 99,031,071 L23F probably benign Het
Art2a-ps C T 7: 101,555,211 S40N not run Het
Ash1l A G 3: 88,966,038 T43A probably benign Het
Atp1a2 G A 1: 172,278,064 probably null Het
Azi2 A G 9: 118,061,915 E336G probably benign Het
Cap2 A G 13: 46,646,575 H419R probably damaging Het
Ccdc14 T A 16: 34,723,836 S903T probably damaging Het
Cep72 A T 13: 74,050,122 S380T possibly damaging Het
Clca3a2 C A 3: 144,810,813 E341* probably null Het
Clcnkb T G 4: 141,410,604 I294L probably benign Het
Cyp2d9 T A 15: 82,455,826 M350K probably damaging Het
Dhx40 T G 11: 86,798,967 I266L probably benign Het
Dnah5 G T 15: 28,448,414 E4208* probably null Het
Ephb2 T C 4: 136,771,042 N242S probably damaging Het
Fam13b A T 18: 34,457,691 F478Y probably benign Het
Fastkd2 C G 1: 63,735,460 probably null Het
Fbxo40 T A 16: 36,969,650 D366V probably damaging Het
Fhod3 A T 18: 24,770,494 K95M probably damaging Het
Foxo3 T A 10: 42,275,027 Q136L probably benign Het
Galnt13 A G 2: 55,112,861 D560G probably benign Het
Ghsr A G 3: 27,372,166 S124G probably benign Het
Gkn2 A G 6: 87,378,286 probably null Het
Glyctk T A 9: 106,156,439 R68W unknown Het
Gm10031 G A 1: 156,525,395 A389T probably benign Het
Gm14025 T C 2: 129,036,994 E1004G unknown Het
Gm5157 G A 7: 21,184,716 P301S unknown Het
Hdc A T 2: 126,616,210 I64N probably damaging Het
Helq A T 5: 100,792,561 probably null Het
Ighv1-43 T C 12: 114,945,963 Y113C probably damaging Het
Ipo9 T C 1: 135,406,853 T273A probably benign Het
Itga4 G A 2: 79,316,045 V774I probably benign Het
Itpr3 T C 17: 27,116,777 L2287P probably damaging Het
Llgl1 T A 11: 60,707,312 I394N probably damaging Het
Mta1 G A 12: 113,131,688 R487H probably benign Het
Neb T C 2: 52,147,669 D7049G probably benign Het
Nlrp4f G A 13: 65,195,018 S271F probably damaging Het
Noxo1 A G 17: 24,699,382 D172G probably damaging Het
Nup155 T A 15: 8,121,507 V347E probably damaging Het
Oaf G T 9: 43,222,671 A251E possibly damaging Het
Pds5b T A 5: 150,792,172 F1039I probably damaging Het
Pla2g12b T A 10: 59,421,240 probably null Het
Prmt3 A G 7: 49,787,301 D208G possibly damaging Het
Ptcd3 G A 6: 71,888,608 T441M probably damaging Het
Rabl6 A G 2: 25,584,774 probably null Het
Shtn1 T A 19: 59,003,896 I417F probably damaging Het
Slc20a2 T C 8: 22,540,401 S158P probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Spata5 A G 3: 37,578,810 D855G probably benign Het
Spef2 T C 15: 9,717,563 Y232C probably damaging Het
Stard9 C T 2: 120,704,461 T3733I probably benign Het
Thrap3 A T 4: 126,178,062 F512L probably benign Het
Tmem150c A T 5: 100,093,104 I30K probably damaging Het
Tnnt1 C T 7: 4,508,583 A168T probably damaging Het
Trak2 A G 1: 58,918,824 L308P probably damaging Het
Trp53i11 T C 2: 93,198,899 L81P probably damaging Het
Usp16 T C 16: 87,474,584 Y344H probably benign Het
Wdr60 T A 12: 116,255,939 K128* probably null Het
Xrcc5 G T 1: 72,356,826 V593L probably benign Het
Zcchc14 A T 8: 121,604,895 H576Q unknown Het
Zfp616 T A 11: 74,085,445 C847S probably damaging Het
Zfp626 A T 7: 27,819,499 Y635F probably benign Het
Zfp799 G A 17: 32,819,499 R598* probably null Het
Zfp831 A G 2: 174,645,304 K591E possibly damaging Het
Other mutations in Gadl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Gadl1 APN 9 115954839 critical splice donor site probably null
IGL01343:Gadl1 APN 9 116074112 makesense probably null
IGL01693:Gadl1 APN 9 115949585 missense probably damaging 1.00
IGL02106:Gadl1 APN 9 115937157 utr 5 prime probably benign
IGL02740:Gadl1 APN 9 116006561 nonsense probably null
IGL03063:Gadl1 APN 9 115966267 missense probably damaging 1.00
IGL03104:Gadl1 APN 9 116074040 missense possibly damaging 0.93
IGL03127:Gadl1 APN 9 115948664 missense probably damaging 1.00
R0133:Gadl1 UTSW 9 115941343 missense probably benign 0.00
R0285:Gadl1 UTSW 9 116030738 splice site probably benign
R0737:Gadl1 UTSW 9 116073987 missense probably damaging 0.99
R0771:Gadl1 UTSW 9 115944232 missense probably damaging 1.00
R1522:Gadl1 UTSW 9 115944229 missense probably damaging 1.00
R1716:Gadl1 UTSW 9 116006508 nonsense probably null
R2061:Gadl1 UTSW 9 115941380 missense probably damaging 1.00
R2163:Gadl1 UTSW 9 115949558 missense possibly damaging 0.93
R3854:Gadl1 UTSW 9 116006664 nonsense probably null
R3964:Gadl1 UTSW 9 115965608 missense probably damaging 0.98
R4654:Gadl1 UTSW 9 115941340 missense probably damaging 1.00
R4724:Gadl1 UTSW 9 115954617 missense possibly damaging 0.81
R4765:Gadl1 UTSW 9 115966313 missense probably null 0.00
R4956:Gadl1 UTSW 9 116040919 missense probably benign 0.00
R5179:Gadl1 UTSW 9 115960380 nonsense probably null
R5593:Gadl1 UTSW 9 116006650 missense probably damaging 1.00
R5620:Gadl1 UTSW 9 115937162 start codon destroyed probably benign 0.09
R6048:Gadl1 UTSW 9 116006701 splice site probably null
R6458:Gadl1 UTSW 9 116041002 makesense probably null
R7497:Gadl1 UTSW 9 116074087 missense probably benign 0.00
Z1088:Gadl1 UTSW 9 115937270 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATTGGCACTCAGAACGTGTAC -3'
(R):5'- ATGAAAGTCCCCGAGAAATCG -3'

Sequencing Primer
(F):5'- GCACTCAGAACGTGTACTTTGTAG -3'
(R):5'- GGAGAGCCGTGCACCAAG -3'
Posted On2019-12-20