Incidental Mutation 'R7889:Dync2i1'
ID 609228
Institutional Source Beutler Lab
Gene Symbol Dync2i1
Ensembl Gene ENSMUSG00000042050
Gene Name dynein 2 intermediate chain 1
Synonyms Dync2l1, D430033N04Rik, Wdr60
MMRRC Submission 045941-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7889 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 116169882-116226642 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 116219559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 128 (K128*)
Ref Sequence ENSEMBL: ENSMUSP00000047334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039349] [ENSMUST00000222679]
AlphaFold Q8C761
Predicted Effect probably null
Transcript: ENSMUST00000039349
AA Change: K128*
SMART Domains Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: K128*

DomainStartEndE-ValueType
coiled coil region 84 122 N/A INTRINSIC
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
coiled coil region 280 309 N/A INTRINSIC
low complexity region 319 337 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
WD40 629 668 2.77e-1 SMART
Blast:WD40 694 755 2e-7 BLAST
WD40 846 881 3.84e0 SMART
WD40 884 926 5.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222679
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg2a A G 3: 37,632,959 (GRCm39) D855G probably benign Het
Angptl3 C T 4: 98,919,308 (GRCm39) L23F probably benign Het
Art2a C T 7: 101,204,418 (GRCm39) S40N not run Het
Ash1l A G 3: 88,873,345 (GRCm39) T43A probably benign Het
Atp1a2 G A 1: 172,105,631 (GRCm39) probably null Het
Azi2 A G 9: 117,890,983 (GRCm39) E336G probably benign Het
Cap2 A G 13: 46,800,051 (GRCm39) H419R probably damaging Het
Ccdc14 T A 16: 34,544,206 (GRCm39) S903T probably damaging Het
Cep72 A T 13: 74,198,241 (GRCm39) S380T possibly damaging Het
Clca3a2 C A 3: 144,516,574 (GRCm39) E341* probably null Het
Clcnkb T G 4: 141,137,915 (GRCm39) I294L probably benign Het
Csnk2a1-ps3 G A 1: 156,352,965 (GRCm39) A389T probably benign Het
Cyp2d9 T A 15: 82,340,027 (GRCm39) M350K probably damaging Het
Dhx40 T G 11: 86,689,793 (GRCm39) I266L probably benign Het
Dnah5 G T 15: 28,448,560 (GRCm39) E4208* probably null Het
Ephb2 T C 4: 136,498,353 (GRCm39) N242S probably damaging Het
Fam13b A T 18: 34,590,744 (GRCm39) F478Y probably benign Het
Fastkd2 C G 1: 63,774,619 (GRCm39) probably null Het
Fbxo40 T A 16: 36,790,012 (GRCm39) D366V probably damaging Het
Fhod3 A T 18: 24,903,551 (GRCm39) K95M probably damaging Het
Foxo3 T A 10: 42,151,023 (GRCm39) Q136L probably benign Het
Gadl1 A T 9: 115,783,883 (GRCm39) Q236L possibly damaging Het
Galnt13 A G 2: 55,002,873 (GRCm39) D560G probably benign Het
Ghsr A G 3: 27,426,315 (GRCm39) S124G probably benign Het
Gkn2 A G 6: 87,355,268 (GRCm39) probably null Het
Glyctk T A 9: 106,033,638 (GRCm39) R68W unknown Het
Gm5157 G A 7: 20,918,641 (GRCm39) P301S unknown Het
Hdc A T 2: 126,458,130 (GRCm39) I64N probably damaging Het
Helq A T 5: 100,940,427 (GRCm39) probably null Het
Ighv1-43 T C 12: 114,909,583 (GRCm39) Y113C probably damaging Het
Ipo9 T C 1: 135,334,591 (GRCm39) T273A probably benign Het
Itga4 G A 2: 79,146,389 (GRCm39) V774I probably benign Het
Itpr3 T C 17: 27,335,751 (GRCm39) L2287P probably damaging Het
Llgl1 T A 11: 60,598,138 (GRCm39) I394N probably damaging Het
Mta1 G A 12: 113,095,308 (GRCm39) R487H probably benign Het
Neb T C 2: 52,037,681 (GRCm39) D7049G probably benign Het
Nlrp4f G A 13: 65,342,832 (GRCm39) S271F probably damaging Het
Noxo1 A G 17: 24,918,356 (GRCm39) D172G probably damaging Het
Nup155 T A 15: 8,150,991 (GRCm39) V347E probably damaging Het
Oaf G T 9: 43,133,968 (GRCm39) A251E possibly damaging Het
Pds5b T A 5: 150,715,637 (GRCm39) F1039I probably damaging Het
Pla2g12b T A 10: 59,257,062 (GRCm39) probably null Het
Prmt3 A G 7: 49,437,049 (GRCm39) D208G possibly damaging Het
Ptcd3 G A 6: 71,865,592 (GRCm39) T441M probably damaging Het
Rabl6 A G 2: 25,474,786 (GRCm39) probably null Het
Shtn1 T A 19: 58,992,328 (GRCm39) I417F probably damaging Het
Slc20a2 T C 8: 23,030,417 (GRCm39) S158P probably damaging Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Spef2 T C 15: 9,717,649 (GRCm39) Y232C probably damaging Het
Stard9 C T 2: 120,534,942 (GRCm39) T3733I probably benign Het
Thrap3 A T 4: 126,071,855 (GRCm39) F512L probably benign Het
Tmem150c A T 5: 100,240,963 (GRCm39) I30K probably damaging Het
Tnnt1 C T 7: 4,511,582 (GRCm39) A168T probably damaging Het
Trak2 A G 1: 58,957,983 (GRCm39) L308P probably damaging Het
Trp53i11 T C 2: 93,029,244 (GRCm39) L81P probably damaging Het
Usp16 T C 16: 87,271,472 (GRCm39) Y344H probably benign Het
Vinac1 T C 2: 128,878,914 (GRCm39) E1004G unknown Het
Xrcc5 G T 1: 72,395,985 (GRCm39) V593L probably benign Het
Zcchc14 A T 8: 122,331,634 (GRCm39) H576Q unknown Het
Zfp616 T A 11: 73,976,271 (GRCm39) C847S probably damaging Het
Zfp626 A T 7: 27,518,924 (GRCm39) Y635F probably benign Het
Zfp799 G A 17: 33,038,473 (GRCm39) R598* probably null Het
Zfp831 A G 2: 174,487,097 (GRCm39) K591E possibly damaging Het
Other mutations in Dync2i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Dync2i1 APN 12 116,205,400 (GRCm39) missense probably benign 0.01
IGL00668:Dync2i1 APN 12 116,221,048 (GRCm39) missense probably benign 0.32
IGL00914:Dync2i1 APN 12 116,196,223 (GRCm39) missense probably damaging 1.00
IGL01061:Dync2i1 APN 12 116,193,324 (GRCm39) missense probably benign 0.45
IGL01375:Dync2i1 APN 12 116,193,296 (GRCm39) missense possibly damaging 0.91
IGL01758:Dync2i1 APN 12 116,182,418 (GRCm39) missense possibly damaging 0.82
IGL01930:Dync2i1 APN 12 116,189,583 (GRCm39) critical splice donor site probably null
IGL02028:Dync2i1 APN 12 116,219,681 (GRCm39) missense probably benign 0.06
IGL03180:Dync2i1 APN 12 116,182,485 (GRCm39) missense probably benign 0.07
F5770:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
R0153:Dync2i1 UTSW 12 116,196,256 (GRCm39) missense probably benign 0.01
R0265:Dync2i1 UTSW 12 116,221,026 (GRCm39) splice site probably benign
R0364:Dync2i1 UTSW 12 116,221,097 (GRCm39) splice site probably benign
R0601:Dync2i1 UTSW 12 116,219,555 (GRCm39) missense possibly damaging 0.79
R0624:Dync2i1 UTSW 12 116,211,910 (GRCm39) missense probably damaging 0.98
R0755:Dync2i1 UTSW 12 116,175,412 (GRCm39) missense probably benign 0.01
R1023:Dync2i1 UTSW 12 116,196,277 (GRCm39) missense probably damaging 1.00
R1065:Dync2i1 UTSW 12 116,219,696 (GRCm39) missense probably damaging 0.98
R1543:Dync2i1 UTSW 12 116,195,404 (GRCm39) splice site probably benign
R1663:Dync2i1 UTSW 12 116,193,230 (GRCm39) missense probably benign 0.01
R1678:Dync2i1 UTSW 12 116,189,590 (GRCm39) missense probably damaging 1.00
R1719:Dync2i1 UTSW 12 116,219,532 (GRCm39) missense probably benign
R1755:Dync2i1 UTSW 12 116,189,649 (GRCm39) missense probably damaging 0.98
R1832:Dync2i1 UTSW 12 116,171,363 (GRCm39) missense probably damaging 0.99
R1918:Dync2i1 UTSW 12 116,196,221 (GRCm39) missense probably damaging 0.96
R2291:Dync2i1 UTSW 12 116,193,191 (GRCm39) splice site probably null
R2444:Dync2i1 UTSW 12 116,196,289 (GRCm39) missense possibly damaging 0.93
R3419:Dync2i1 UTSW 12 116,188,597 (GRCm39) missense probably benign 0.05
R3699:Dync2i1 UTSW 12 116,175,462 (GRCm39) nonsense probably null
R3700:Dync2i1 UTSW 12 116,175,462 (GRCm39) nonsense probably null
R4445:Dync2i1 UTSW 12 116,171,335 (GRCm39) missense probably damaging 1.00
R4664:Dync2i1 UTSW 12 116,219,831 (GRCm39) missense probably damaging 0.99
R4954:Dync2i1 UTSW 12 116,219,645 (GRCm39) missense probably damaging 1.00
R5057:Dync2i1 UTSW 12 116,177,033 (GRCm39) missense probably benign 0.43
R5163:Dync2i1 UTSW 12 116,219,486 (GRCm39) missense possibly damaging 0.76
R5341:Dync2i1 UTSW 12 116,219,534 (GRCm39) missense possibly damaging 0.51
R5560:Dync2i1 UTSW 12 116,181,733 (GRCm39) missense probably damaging 0.98
R5870:Dync2i1 UTSW 12 116,219,865 (GRCm39) missense possibly damaging 0.94
R5925:Dync2i1 UTSW 12 116,197,014 (GRCm39) missense possibly damaging 0.82
R6223:Dync2i1 UTSW 12 116,221,078 (GRCm39) missense possibly damaging 0.95
R6364:Dync2i1 UTSW 12 116,205,352 (GRCm39) missense probably damaging 1.00
R6450:Dync2i1 UTSW 12 116,210,347 (GRCm39) nonsense probably null
R6462:Dync2i1 UTSW 12 116,193,251 (GRCm39) missense probably benign
R6751:Dync2i1 UTSW 12 116,177,076 (GRCm39) missense possibly damaging 0.52
R6896:Dync2i1 UTSW 12 116,193,291 (GRCm39) missense possibly damaging 0.52
R6962:Dync2i1 UTSW 12 116,175,398 (GRCm39) missense probably damaging 1.00
R7033:Dync2i1 UTSW 12 116,175,511 (GRCm39) missense probably benign 0.03
R7042:Dync2i1 UTSW 12 116,218,061 (GRCm39) missense probably benign 0.02
R7254:Dync2i1 UTSW 12 116,226,205 (GRCm39) intron probably benign
R7567:Dync2i1 UTSW 12 116,218,130 (GRCm39) splice site probably null
R8082:Dync2i1 UTSW 12 116,177,127 (GRCm39) critical splice acceptor site probably null
R8288:Dync2i1 UTSW 12 116,177,345 (GRCm39) missense probably damaging 1.00
R8309:Dync2i1 UTSW 12 116,219,705 (GRCm39) missense probably damaging 1.00
R8682:Dync2i1 UTSW 12 116,188,610 (GRCm39) missense probably damaging 1.00
R8683:Dync2i1 UTSW 12 116,193,262 (GRCm39) missense probably benign 0.03
R8699:Dync2i1 UTSW 12 116,171,321 (GRCm39) missense probably benign 0.01
R8782:Dync2i1 UTSW 12 116,205,332 (GRCm39) missense probably damaging 1.00
R8809:Dync2i1 UTSW 12 116,193,234 (GRCm39) missense probably damaging 0.98
R9281:Dync2i1 UTSW 12 116,211,677 (GRCm39) nonsense probably null
R9530:Dync2i1 UTSW 12 116,175,411 (GRCm39) missense possibly damaging 0.87
R9751:Dync2i1 UTSW 12 116,205,403 (GRCm39) critical splice acceptor site probably null
V7581:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
V7582:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
V7583:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
X0063:Dync2i1 UTSW 12 116,219,489 (GRCm39) missense probably benign
Z1177:Dync2i1 UTSW 12 116,209,719 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACATTCACACAGGAGCGC -3'
(R):5'- AGAGAGACCTGTACACCTCC -3'

Sequencing Primer
(F):5'- GCACATTAGTCAATCAACTGAGC -3'
(R):5'- TCCACAGAACATCCTCGTGGG -3'
Posted On 2019-12-20