Incidental Mutation 'R7889:Cap2'
ID 609229
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene Name cyclase associated actin cytoskeleton regulatory protein 2
Synonyms 2810452G09Rik
MMRRC Submission 045941-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R7889 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 46655379-46803757 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46800051 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 419 (H419R)
Ref Sequence ENSEMBL: ENSMUSP00000021802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
AlphaFold Q9CYT6
Predicted Effect probably damaging
Transcript: ENSMUST00000021802
AA Change: H419R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: H419R

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119341
AA Change: H307R

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373
AA Change: H307R

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126687
Predicted Effect probably damaging
Transcript: ENSMUST00000225824
AA Change: H364R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg2a A G 3: 37,632,959 (GRCm39) D855G probably benign Het
Angptl3 C T 4: 98,919,308 (GRCm39) L23F probably benign Het
Art2a C T 7: 101,204,418 (GRCm39) S40N not run Het
Ash1l A G 3: 88,873,345 (GRCm39) T43A probably benign Het
Atp1a2 G A 1: 172,105,631 (GRCm39) probably null Het
Azi2 A G 9: 117,890,983 (GRCm39) E336G probably benign Het
Ccdc14 T A 16: 34,544,206 (GRCm39) S903T probably damaging Het
Cep72 A T 13: 74,198,241 (GRCm39) S380T possibly damaging Het
Clca3a2 C A 3: 144,516,574 (GRCm39) E341* probably null Het
Clcnkb T G 4: 141,137,915 (GRCm39) I294L probably benign Het
Csnk2a1-ps3 G A 1: 156,352,965 (GRCm39) A389T probably benign Het
Cyp2d9 T A 15: 82,340,027 (GRCm39) M350K probably damaging Het
Dhx40 T G 11: 86,689,793 (GRCm39) I266L probably benign Het
Dnah5 G T 15: 28,448,560 (GRCm39) E4208* probably null Het
Dync2i1 T A 12: 116,219,559 (GRCm39) K128* probably null Het
Ephb2 T C 4: 136,498,353 (GRCm39) N242S probably damaging Het
Fam13b A T 18: 34,590,744 (GRCm39) F478Y probably benign Het
Fastkd2 C G 1: 63,774,619 (GRCm39) probably null Het
Fbxo40 T A 16: 36,790,012 (GRCm39) D366V probably damaging Het
Fhod3 A T 18: 24,903,551 (GRCm39) K95M probably damaging Het
Foxo3 T A 10: 42,151,023 (GRCm39) Q136L probably benign Het
Gadl1 A T 9: 115,783,883 (GRCm39) Q236L possibly damaging Het
Galnt13 A G 2: 55,002,873 (GRCm39) D560G probably benign Het
Ghsr A G 3: 27,426,315 (GRCm39) S124G probably benign Het
Gkn2 A G 6: 87,355,268 (GRCm39) probably null Het
Glyctk T A 9: 106,033,638 (GRCm39) R68W unknown Het
Gm5157 G A 7: 20,918,641 (GRCm39) P301S unknown Het
Hdc A T 2: 126,458,130 (GRCm39) I64N probably damaging Het
Helq A T 5: 100,940,427 (GRCm39) probably null Het
Ighv1-43 T C 12: 114,909,583 (GRCm39) Y113C probably damaging Het
Ipo9 T C 1: 135,334,591 (GRCm39) T273A probably benign Het
Itga4 G A 2: 79,146,389 (GRCm39) V774I probably benign Het
Itpr3 T C 17: 27,335,751 (GRCm39) L2287P probably damaging Het
Llgl1 T A 11: 60,598,138 (GRCm39) I394N probably damaging Het
Mta1 G A 12: 113,095,308 (GRCm39) R487H probably benign Het
Neb T C 2: 52,037,681 (GRCm39) D7049G probably benign Het
Nlrp4f G A 13: 65,342,832 (GRCm39) S271F probably damaging Het
Noxo1 A G 17: 24,918,356 (GRCm39) D172G probably damaging Het
Nup155 T A 15: 8,150,991 (GRCm39) V347E probably damaging Het
Oaf G T 9: 43,133,968 (GRCm39) A251E possibly damaging Het
Pds5b T A 5: 150,715,637 (GRCm39) F1039I probably damaging Het
Pla2g12b T A 10: 59,257,062 (GRCm39) probably null Het
Prmt3 A G 7: 49,437,049 (GRCm39) D208G possibly damaging Het
Ptcd3 G A 6: 71,865,592 (GRCm39) T441M probably damaging Het
Rabl6 A G 2: 25,474,786 (GRCm39) probably null Het
Shtn1 T A 19: 58,992,328 (GRCm39) I417F probably damaging Het
Slc20a2 T C 8: 23,030,417 (GRCm39) S158P probably damaging Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Spef2 T C 15: 9,717,649 (GRCm39) Y232C probably damaging Het
Stard9 C T 2: 120,534,942 (GRCm39) T3733I probably benign Het
Thrap3 A T 4: 126,071,855 (GRCm39) F512L probably benign Het
Tmem150c A T 5: 100,240,963 (GRCm39) I30K probably damaging Het
Tnnt1 C T 7: 4,511,582 (GRCm39) A168T probably damaging Het
Trak2 A G 1: 58,957,983 (GRCm39) L308P probably damaging Het
Trp53i11 T C 2: 93,029,244 (GRCm39) L81P probably damaging Het
Usp16 T C 16: 87,271,472 (GRCm39) Y344H probably benign Het
Vinac1 T C 2: 128,878,914 (GRCm39) E1004G unknown Het
Xrcc5 G T 1: 72,395,985 (GRCm39) V593L probably benign Het
Zcchc14 A T 8: 122,331,634 (GRCm39) H576Q unknown Het
Zfp616 T A 11: 73,976,271 (GRCm39) C847S probably damaging Het
Zfp626 A T 7: 27,518,924 (GRCm39) Y635F probably benign Het
Zfp799 G A 17: 33,038,473 (GRCm39) R598* probably null Het
Zfp831 A G 2: 174,487,097 (GRCm39) K591E possibly damaging Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46,793,425 (GRCm39) splice site probably benign
IGL01927:Cap2 APN 13 46,789,109 (GRCm39) missense probably benign 0.03
IGL02213:Cap2 APN 13 46,789,087 (GRCm39) splice site probably benign
IGL02511:Cap2 APN 13 46,684,498 (GRCm39) start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46,678,968 (GRCm39) missense probably benign 0.00
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0385:Cap2 UTSW 13 46,714,023 (GRCm39) missense probably damaging 1.00
R0387:Cap2 UTSW 13 46,713,992 (GRCm39) missense probably damaging 0.99
R0712:Cap2 UTSW 13 46,768,837 (GRCm39) splice site probably null
R1489:Cap2 UTSW 13 46,763,111 (GRCm39) missense probably damaging 1.00
R1666:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1668:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1676:Cap2 UTSW 13 46,791,335 (GRCm39) missense probably damaging 1.00
R1756:Cap2 UTSW 13 46,684,489 (GRCm39) missense probably benign 0.11
R1822:Cap2 UTSW 13 46,768,823 (GRCm39) missense probably benign 0.03
R1867:Cap2 UTSW 13 46,793,555 (GRCm39) missense probably damaging 1.00
R1972:Cap2 UTSW 13 46,791,375 (GRCm39) missense probably damaging 0.98
R1990:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46,713,978 (GRCm39) critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46,793,317 (GRCm39) missense probably benign 0.20
R4024:Cap2 UTSW 13 46,791,317 (GRCm39) splice site probably benign
R4554:Cap2 UTSW 13 46,789,250 (GRCm39) missense probably damaging 1.00
R4748:Cap2 UTSW 13 46,793,302 (GRCm39) missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46,763,586 (GRCm39) missense probably damaging 0.99
R4876:Cap2 UTSW 13 46,684,497 (GRCm39) start codon destroyed probably null
R4902:Cap2 UTSW 13 46,684,501 (GRCm39) missense probably damaging 0.99
R5320:Cap2 UTSW 13 46,801,840 (GRCm39) makesense probably null
R5666:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R5670:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R6086:Cap2 UTSW 13 46,789,188 (GRCm39) missense probably damaging 1.00
R6728:Cap2 UTSW 13 46,793,335 (GRCm39) missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46,800,101 (GRCm39) missense probably damaging 1.00
R7785:Cap2 UTSW 13 46,789,224 (GRCm39) missense probably benign
R8065:Cap2 UTSW 13 46,791,337 (GRCm39) missense probably damaging 1.00
R8205:Cap2 UTSW 13 46,768,739 (GRCm39) missense probably damaging 1.00
R8425:Cap2 UTSW 13 46,763,208 (GRCm39) missense probably damaging 0.98
R8731:Cap2 UTSW 13 46,800,006 (GRCm39) missense probably benign 0.00
R8738:Cap2 UTSW 13 46,684,548 (GRCm39) missense probably benign 0.00
R9320:Cap2 UTSW 13 46,768,818 (GRCm39) missense probably benign 0.04
R9491:Cap2 UTSW 13 46,791,366 (GRCm39) missense possibly damaging 0.92
R9686:Cap2 UTSW 13 46,678,926 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATGACACTTGCCCTG -3'
(R):5'- AAATGAAGCTCCCGAGATGGC -3'

Sequencing Primer
(F):5'- TTGCCCTGCACGTAGACACAG -3'
(R):5'- TCCCGAGATGGCAGCTGATG -3'
Posted On 2019-12-20